Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig4
Contig Information
Length 788 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvs18p10   
Homology (BLAST) Top Hit hypothetical protein OsI_10008 [Oryza sativa Indica Group]
Score 546
Evalue 6.25606e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig4
CCGCAGGCTCCCCATTCTTTCTTATTAATTCCCGCCGGGCGCGTGCGCGTGCGCGTGGGCGGGCGTACGGCAGCGAGCCTCTCCCGGACTCCGATTCCTT
CCTTCCGGCGGAGCTGATCGCATCTCCTTCTCCTCTCCCAGAGAGGAAACCCGGAGGAAGCAGAGACGGCCGGACAGATGGATTTGGGAGCAGAGCAGCA
CGGCTGCGAGCATTACACGAGGAGGTGCAGGATACGGGCGCCCTGCTGCGGCGAGGTCTTCGGCTGCCGGCATTGCCATAACCAAGCTAAGAATTCGCTG
GAGGTGGACCTCCTCGACCGGCACGAAATCCCCCGCCACGAAATCAGTAAGGTTATCTGCTCTCTCTGCAACAAAGAACAGGATGTGCAACAGAACTGCT
CCGGTTGCGGGGCATGCATGGGAAAATACTTCTGTGAAAAATGCAACTTCTTTGACGATGATATCTCAAAGAAGCAGTACCACTGCGATGGATGCGGCAT
CTGCAGAATGATCAAATGTTGGATACATTGTTCTCCTTATTCAGAACTGGCGGCATAGACAACTTCTTCCACTGCGAAAAATGCGGGTGTTGCTACAGCA
ATGTTTTGAAGGACTCTCATCATTGTGTGGAACGAGCAATGCATCACAACTGCCCTGTCTGCTTCGAGTACCTATTTGACTCGACTATGGACATCANCGT
ACTGCACTGCGGGCACACGATCCATTTGGAATGCCTGAACGAGATGAGGGTTCATCACCACTTCTCGTGCCCGGTCTGCTCACGGTCG
page-top