Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig3
Contig Information
Length 830 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvs17i23   
Homology (BLAST) Top Hit hypothetical protein OsI_09373 [Oryza sativa Indica Group]
Score 575
Evalue 2.23879e-57
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig3
ACTTTTACATGNTTACATTCTACACCTTGCAGAAATACGCCATTCCATGATGAATCCCTAAAATCCTAATATCTTCCTAGGAAAAAGCCTTCTTTTGCTC
CTCCTGCTTTACTCTGTTTATCATTGAACCAGAATGACACTATCATCATTCATTACATAATAGTAGTATTTACATGCTACACTTTATACTTGTAGAAACA
GACAATTCGACGTTGAATTTAGAAAGCATGGTTTCTTGTTCATCTTCTTCTTTCGTTCCTGCTTTGCTCGGTTTATTTCATGAGACAGATTTGTCCCGTG
GCCTGTTACAAGTAGGCACGCTTTTGTGTTATAGGAAGAACGGGCAGAGGCAAGTGGCCCTTTTTCTGCAAGCACGTCACCGTCTCGTACAAACTTTCCC
TCAAAGGAGTGAACTCTAATCCCAGGTCCCTGAGCCTCATGTTAGAGAACTTGTACGGCTTCGCCATGGGCTTGCCGTCGTCTTCACACTTGGCGGTTAT
GTGGTACTGCGGGAAGAGGTCGCCGAGGAGCTGGAGGAAGTGGGCTCGGTGCAGCACGGCGCCGATGCAAAGGTAGCGGCCTCGAGCGTCGGGGTTCTCG
TAGACGAGAGCATGCGCACGGGCTACATCGCGGACGTCGGTGTAGGCAGCGACGGCGTTGGGGTAGGTGGGCTTGGTGCCTGTGAGGTANCGCGCGACGT
GGCTGCTGCTGAAGTTGAGCGCCTGCTGCANCATGGGGCCCATGGNCATGGACGGCACCACCACGGNCANCTCNANCCCCCTCTTGGCCGCCTCCTCCAT
CNCCGNAATCTCCGCCATCNTCTTTGCNCA
page-top