Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2
Contig Information
Length 810 bp
Tissue Liquid cultured tissue
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvs17b01   
Homology (BLAST) Top Hit urate oxidase [Triticum aestivum]
Score 1257
Evalue 1.7741e-136
Total Hit Count 222
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2
GCCGGGCACTTCGACCTCCAGGGCAGGCATGGCAAGTCCCGCGTCCGCGTCTCCCGCGTCTGGCGCCGCCCCGCCGATGCCGGCGGCCACCTCTTCGTCG
AGTGGAGCGTCGCCGTCAGCGTCGTCTCCGACTGCCTCCCATCCTACACCTCCGACGACAACTCCGCCATCGTCGCCACCGACTCCATCAAGAACACCGT
GTATGTGAAGGCCAAGGAGTGCACGGAGGTGGTGTCCATGGAGGAATTCGCGGTCATCCTCGGGAGGCATTTCACCTCACTGTACCCGCAGGTCTCAGAG
GCTGCAGTGACAATCGTGGAGCGCCCATGGGAGCGTGTGGCTGTGGACGGGAAGCCCCATTCGCATGGGTTCAAACTTGGTTCTGAAAAGCACACCACAG
AGGTCACGGTGAAGAAGTCTGGAAGCCTGCTTATAAATTCTGGGATACAAGGATACTCCCTGCTAAAGACAACTCAGTCTGGATTTGAAGGATTCATGAG
GGACCGCTACACTCTTCTTCCTGAAACAAGAGAAAGAATTGTAGCAACAGAAGTAACTGCTTGGTGGAGGTATCCGTTCGAGCATATTTCCCAGCTTCCG
TCAAAGCCATTTTGCTTCACACAAAGATACCAGGATGTAAAGAAGGTTCTTGCAGACACATTCTTTGGTCCTTCTGATGTTGGTGTATATAGTCCATCCG
TGCANAATACATTATACCTCATGGCTANGGAAGTTCTTACCANGTTCCCAGACATANCATCCGTTCANCTTANGATGCCAAACCTCCACTTTCTTCCCCG
TGAACCTANG
page-top