Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1484
Contig Information
Length 897 bp
Tissue Shoot with heat shock treatment
Clones 197 Clones [Download: CSV  ,  FASTA ]
whvh10d22    whvh10g24    whvh11b22    whvh11f11    whvh11f12    whvh11o06    whvh11p01    whvh11p02    whvh12f24    whvh12h22    whvh12o01    whvh12o18    whvh1d06    whvh1d10    whvh1e18    whvh1f24    whvh1h01    whvh1i22    whvh1m06    whvh1n06    whvh1o10    whvh2d02    whvh2i08    whvh2i09    whvh2k09    whvh2l22    whvh2o03    whvh2o09    whvh2o10    whvh3m20    whvh4i02    whvh4p02    whvh5b19    whvh5d04    whvh5g11    whvh5h11    whvh5h22    whvh5i14    whvh5k11    whvh6c13    whvh6d09    whvh6e05    whvh6e23    whvh6g22    whvh6m03    whvh7a03    whvh7c11    whvh7d01    whvh7i15    whvh7j02    whvh7k04    whvh7k24    whvh7l18    whvh7m01    whvh8b14    whvh8j17    whvh8m22    whvh8o18    whvh9e03    whvh9g07    whvh9m20    whvh13p04    whvh13p14    whvh14h14    whvh14j09    whvh15a06    whvh15a17    whvh15g02    whvh15g04    whvh15g18    whvh15n12    whvh16d09    whvh16h15    whvh16i20    whvh16j05    whvh16j17    whvh16k05    whvh17k16    whvh18a08    whvh18c13    whvh18e08    whvh18f03    whvh18g01    whvh18h13    whvh18n11    whvh19a18    whvh19f06    whvh19g11    whvh19h20    whvh19h22    whvh19l11    whvh19l16    whvh20a19    whvh20c22    whvh20d02    whvh20p14    rwhvh10d22    rwhvh10g24    rwhvh10l10    rwhvh10l23    rwhvh11d22    rwhvh11f11    rwhvh11i21    rwhvh11j11    rwhvh11o06    rwhvh11o23    rwhvh11p01    rwhvh12f23    rwhvh12h22    rwhvh12n04    rwhvh12o01    rwhvh12o18    rwhvh1d06    rwhvh1d10    rwhvh1e18    rwhvh1h01    rwhvh1h12    rwhvh1i22    rwhvh1m06    rwhvh1n06    rwhvh1o10    rwhvh2d02    rwhvh2i08    rwhvh2i09    rwhvh2k09    rwhvh2l22    rwhvh2o03    rwhvh2o10    rwhvh3m20    rwhvh4g05    rwhvh4i02    rwhvh4p02    rwhvh5b19    rwhvh5d04    rwhvh5g11    rwhvh5h11    rwhvh5i14    rwhvh5k11    rwhvh6c13    rwhvh6d09    rwhvh6e05    rwhvh6e23    rwhvh6g22    rwhvh6m03    rwhvh7a03    rwhvh7c11    rwhvh7d01    rwhvh7j02    rwhvh7k04    rwhvh7l18    rwhvh7m01    rwhvh8b14    rwhvh8m22    rwhvh8o18    rwhvh9b19    rwhvh9e03    rwhvh9g07    rwhvh9m20    rwhvh13o17    rwhvh13p04    rwhvh13p14    rwhvh14a05    rwhvh14h14    rwhvh14j09    rwhvh15a06    rwhvh15a17    rwhvh15g02    rwhvh15g04    rwhvh15g18    rwhvh16d09    rwhvh16h15    rwhvh16j02    rwhvh16j05    rwhvh16j17    rwhvh16k05    rwhvh17k05    rwhvh17k16    rwhvh17l03    rwhvh18a08    rwhvh18c13    rwhvh18c18    rwhvh18e08    rwhvh18g01    rwhvh18h13    rwhvh18n11    rwhvh19a18    rwhvh19f06    rwhvh19g11    rwhvh19h22    rwhvh19i08    rwhvh19l11    rwhvh19l16    rwhvh20a19    rwhvh20c22    rwhvh20d02    rwhvh20d13    rwhvh20p14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 919
Evalue 3.31911e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1484
TTTTTTTTTTGCGGTGGCAAAGATGTTTCTCATTAATTACCCAAATACATAGTCGACAGATTGTACTTATAATATTATGTGCATGTGCATATACATAGCC
ATCGGTAGCATTCACATACGCAGCATGCTTTCTCGAGTCATGTCGGGAACATGGACATACACATATTCTTATCTTAGGAACAAACAAGAAAGATAAATGG
AAAAGGAAAACCCAAAGCAATGTCAGAGTTGACAAAACCGCAATGGCACTTTATATGTGGCCCGTGGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCTC
GCAGCCCGGTGGCTTGAAGGCGATGAAGCTGACGCACTGCACCTGGCGCATGTTGTCGAATCCGATGATGCGGACATACGCGTCAGGGTACTCCTTCTTG
ACCTCCTCCACCTCGTTGATCACCTGCGTGGCGTCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTACCGGCCATCGTAGTACCCAGGGGATG
CGTTGTGCTCACGGAAGATAAACCCAACCTTGCTGAACTCGAGGCAAGGCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTGAGGAGGGCCTCCGT
GCTGAGCGGTGGCAGGTAGGACAGGGTCTCGAACTTCTTAATGCCCTCGATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTGCCG
AGGCTAGCGCCGTTGGAGCGGCGGCTGACGGGGAGGCCGGCGGTGGACTTGAGCCCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCATCACGGTGG
GGGGCCATGGGCTGTACTATGTAGGTATATAGCTTGCTAGGAGGAGGCACCATCTCCCCTCCCCCACCCCACCCCCGGGTTTATTTGATAAGATTTG
page-top