Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1482
Contig Information
Length 1270 bp
Tissue Shoot with heat shock treatment
Clones 136 Clones [Download: CSV  ,  FASTA ]
whvh10c20    whvh10c24    whvh10f19    whvh10h02    whvh10k11    whvh11b13    whvh11c20    whvh11l23    whvh12g23    whvh12m16    whvh12p08    whvh1b02    whvh1h11    whvh1i04    whvh2a03    whvh2a21    whvh2b24    whvh2n05    whvh2o22    whvh3a08    whvh3a21    whvh3b14    whvh3e22    whvh3k05    whvh4i09    whvh4l07    whvh4l14    whvh5b22    whvh5d17    whvh5o11    whvh6b22    whvh6f12    whvh6h07    whvh7f12    whvh8g01    whvh8i19    whvh9d09    whvh9i22    whvh9j09    whvh13f09    whvh13h12    whvh13j24    whvh13m05    whvh13m12    whvh13m24    whvh13n11    whvh14d09    whvh14f05    whvh14g17    whvh14g21    whvh14m10    whvh14o08    whvh16j21    whvh16j23    whvh16o10    whvh16o19    whvh17k15    whvh17o05    whvh18b04    whvh18h20    whvh18n03    whvh18p22    whvh19c12    whvh19e01    whvh19l21    whvh19p05    whvh20b03    whvh20m24    whvh20n11    whvh20n20    rwhvh10c20    rwhvh10c24    rwhvh10f19    rwhvh10h02    rwhvh10k11    rwhvh11c20    rwhvh11l23    rwhvh12g23    rwhvh12m16    rwhvh12o06    rwhvh12p08    rwhvh1b02    rwhvh1h11    rwhvh1i04    rwhvh2a03    rwhvh2a21    rwhvh2b24    rwhvh2n05    rwhvh2o22    rwhvh3a08    rwhvh3a21    rwhvh3b14    rwhvh3e22    rwhvh4i09    rwhvh4l07    rwhvh4l14    rwhvh5a07    rwhvh5o11    rwhvh6b22    rwhvh6f12    rwhvh6h07    rwhvh7f12    rwhvh7i22    rwhvh8g01    rwhvh8i19    rwhvh9d09    rwhvh9i22    rwhvh13f09    rwhvh13h12    rwhvh13j24    rwhvh13m12    rwhvh13n11    rwhvh14d09    rwhvh14f05    rwhvh14g17    rwhvh14g21    rwhvh14m10    rwhvh14o08    rwhvh16j21    rwhvh16j23    rwhvh16o10    rwhvh16o19    rwhvh17f07    rwhvh17k15    rwhvh17o05    rwhvh17p06    rwhvh18b04    rwhvh18h20    rwhvh18n03    rwhvh19c12    rwhvh19e01    rwhvh19p05    rwhvh20b03    rwhvh20m24    rwhvh20n11    rwhvh20n20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 928
Evalue 5.06878e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1482
GTATTTCTCTATAAAACATTGGGTCTCTTACATTTCGAGTGGTTGAAGACGAGCAAAGGAGGGAGGACAACATGGCAGGTTTAGAACGGTACATGAAAGG
AATTGAGACGCGACAAAATGAAGCTTAGCCTCATACGGTCACCGACCTCGTCATGACACCTTCATCAAGTGCAACGACTCCAGGCAGCTCCTTTCCTTCC
AACAGCTCCAAGCTAGCGCCACCACCAGTTGAGATGTGGCTCATAACATCAGCCTCCTAGCAAGCTATATACCTACATAGTACAGCCATGGCCCCCACCG
TGATGGCCTCGTCGGCCACCTCCGTCGCTCCTTTCCAGGGGCTCAAGTCCACCGCCGGCCTCCCCGTCAGCCGCCGCTCCAACGGCGCTAGCCTCGGCAG
CGTCAGCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCCATTGAGGGCATCAAGAAGTTCGAGACCCTGTCCTACTTGCCACCGCTCAGCACGGAG
GCCCTCCTCAAGCAGGTCGACTACCTGATCCGCTCCAAGTGGGTGCCTTGCCTCGAGTTCAGCAAGGTTGGGTTCATCTTCCGTGAGCACAACGCATCCC
CTGGGTACTATGATGGCCGGTACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACCGACGCCACACAAGTGATCAACGAGGTGGAGGAGGTCAAGAA
GGAGTACCCTGACGCGTATGTCCGCATCATCGGATTCGACAACATGCGCCAGGTGCAGTGCGTCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAG
TCCGGCAAGGCCTAAACAGCTCACTCACGACAGGCCATATATAAAGTGCCATTGCAGTTTTGTCAACTCTGACATTGCTTTGGGTTTTCCTTCTCCATTT
ATCTTTCTTATTTGTTCCTAAGAATATGTGTATGTCCATGTTCATGTACCAACATGGCTCGAGAAAGCATGCTCGTATGAGAATGCTATGCGGTGGCTAT
GTATATGAAGCGGACGCATAATATTATACAATATGTCGACTATATACGTTTTAATGGTAACCAATGGAAAATATCTCCACCACCGTGCTTATTACTTCCT
CTGTAAATTAATATAGAGCGTTTCGATCACTGCTTTAGTGATCTAAACGCTCTTATGTTAGTTTACAGAGGGGATACTTTTTATTAATAGTGGACGGTTG
GACGTTGTCTTAGTTTGTATCCCTGAAATGTATGGTTGTAAANCATGGCCCCACAGAATGTGGCCAACAA
page-top