Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1480
Contig Information
Length 1696 bp
Tissue Shoot with heat shock treatment
Clones 121 Clones [Download: CSV  ,  FASTA ]
whvh10b10    whvh10n19    whvh11b02    whvh11h08    whvh12b16    whvh12p18    whvh1g12    whvh1p10    whvh2c02    whvh2e09    whvh2o06    whvh3f23    whvh3i02    whvh3k14    whvh3o05    whvh3o10    whvh4m17    whvh5a05    whvh6c04    whvh6f08    whvh6i20    whvh6l21    whvh6n08    whvh7c24    whvh7f11    whvh7i06    whvh7j14    whvh7p10    whvh8b15    whvh8e03    whvh8n21    whvh9j14    whvh9k11    whvh9l05    whvh9l20    whvh9n12    whvh9o08    whvh9o17    whvh13b12    whvh13i07    whvh13n04    whvh14c21    whvh14i06    whvh14j03    whvh14k03    whvh15a19    whvh15d19    whvh15i13    whvh17b02    whvh17l04    whvh18e14    whvh18f05    whvh18k01    whvh19f23    whvh19k13    whvh19k21    whvh20e15    whvh20g22    whvh20g23    whvh20h09    whvh20i12    whvh20o19    whvh20o20    rwhvh10b10    rwhvh10n19    rwhvh11b02    rwhvh11h08    rwhvh12p18    rwhvh1g12    rwhvh1p10    rwhvh2c02    rwhvh2e09    rwhvh2n04    rwhvh2o06    rwhvh3f23    rwhvh3i02    rwhvh3k14    rwhvh3o05    rwhvh3o10    rwhvh5a05    rwhvh6c04    rwhvh6f08    rwhvh6i20    rwhvh6l21    rwhvh6n08    rwhvh7c24    rwhvh7f11    rwhvh7i06    rwhvh7j14    rwhvh8b15    rwhvh8e03    rwhvh8i24    rwhvh8n21    rwhvh9j14    rwhvh9k11    rwhvh9l05    rwhvh9l20    rwhvh9n12    rwhvh9o08    rwhvh9o17    rwhvh9p02    rwhvh13i07    rwhvh13n04    rwhvh14c21    rwhvh14h20    rwhvh14j03    rwhvh14k03    rwhvh15a19    rwhvh17b02    rwhvh17l04    rwhvh18e14    rwhvh18f05    rwhvh18k01    rwhvh19f23    rwhvh19k13    rwhvh19k21    rwhvh20g23    rwhvh20h09    rwhvh20i12    rwhvh20o19    rwhvh20o20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic; Short=RuBisCO activase A; Short=RA A; Flags: Precursor >gi|167097|gb|AAA63164.1| ribulose 1,5-bisphosphate carboxylase activase isoform 2 [Hordeum vulgare subsp. vulgare]
Score 1117
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1480
GCCGGTCATTCATCACCGAATCACCAGCACAGGCCGCGCATCCACCGTTTGCTAGCAAGGTCGACCAAGCAGCACCGAGATGGCTGCTGCCTTCTCCTCC
ACCGTCGGTGCCCCGGCTTCTACGCCGACCAACTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGGCAAGAGCTCCAAG
GCCAACAGGTTCACAGTCATGGCAGCGGAAAACCTCGACGAGAAGAGGAACACGGACAAGTGGAAGGGTCTTGCGTACGATATCTCCGACGACCAGCAGG
ACATCACCAGAGGGAAGGGCATCGTGGACTCGCTCTTCCAGGCGCCCACGGGCGACGGCACCCACGAGGCCGTCCTCAGCTCCTACGAGTACGTCAGCCA
GGGACTCAAGAAGTACGACTTCGACAACACCATGGGAGGCTTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTCCATCTCTCCAAGAACTTCATG
ACCCTGCCCAACATCAAGATCCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCATTCCAGTGCGAGCTTGTCTTCGCCAAGATGGGCA
TCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGTGGCAACGCCGGAGAGCCAGCCAAGCTCATCAGGCAGCGGTACCGTGAGGCTGCAGACATGAT
CAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTTGACGCTGGTGCGGGTCGGATGGGCGGGACCACACAGTACACCGTCAACAACCAGATGGTG
AACGCCACCCTCATGAACATCGCCGATGCCCCCCACCAACGTGCAGCTCCCAGGCATGTACAACAAGGAGGAGAACCCTCGTGTGCCCATCGTCGTCACT
GGTAACGATTTCTCGACGTTGTACGCCCCTCTGATCCGTGATGGCCGTATGGAGAAGTTCTACTGGGCTCCCACCCGCGACGACCGTATCGGTGTCTGCA
AGGGTATCTTCCAGACCGACAATGTCAGCGACGAGTCCGTCGTCAAGATCGTCGACACCTTCCCAGGACAATCCATCGACTTTTTCGGTGCTCTGCGTGC
TCGGGTGTACGACGACGAGGTGCGCAAGTGGGTGACCTCTACCGGTATCGAGAACATTGGCAAGAGGCTGGTGAACTCGCGGGACGGACCCGTGACCTTT
GAGCAGCCAAAGATGACAGTGGAGAAGCTGCTAGAGTACGGGCACATGCTTGTCCAGGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACACCTACA
TGAGCCAGGCAGCTCTGGGTGATGCTAACCAGGATGCGATGAAGACTGGTTCCTTCTACGGTTAGAACATTCTCCATACACACCCACCATCTCTTGCTGC
ATAGGAGGAGGTAAAGGGGCACAGCAAGGTACTTTGCCTGTACCGGCAGGATGCACCGACCAGACTGCCAAGAACTTCGACCCAACGGCGAGGAGTGACG
ACGGGAGCTGCCTTTACACCTTTTAAGCATGCCAATTTAATATCTGATGTTTTATCCTTTGTACCTAAGTACCGCATCGCATCCAAGCGATTGCTGGGCC
ATGTTTTGTTAATATAAAAAGATATTGAGTATACCTATTTGGTAAAGACAAATAGAACTACTTATCATTTGTCACTCTCTGTATTCATTCCTTCAG
page-top