Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1479
Contig Information
Length 848 bp
Tissue Shoot with heat shock treatment
Clones 109 Clones [Download: CSV  ,  FASTA ]
whvh10b07    whvh10k05    whvh10p13    whvh11f14    whvh11g05    whvh12a18    whvh12d11    whvh12o09    whvh1a19    whvh1e12    whvh1f08    whvh1i08    whvh1i24    whvh1k24    whvh1l21    whvh2j15    whvh2j16    whvh3c04    whvh3d03    whvh3d07    whvh4b22    whvh4f15    whvh4h17    whvh4l03    whvh6k07    whvh6k18    whvh6o22    whvh8b19    whvh8c02    whvh8e11    whvh8j02    whvh9d02    whvh9i15    whvh13k05    whvh13p11    whvh14f03    whvh14f17    whvh14j17    whvh14p11    whvh15e04    whvh15e15    whvh15f07    whvh15j02    whvh15l24    whvh16g07    whvh17a10    whvh17b04    whvh17g15    whvh17o04    whvh18c22    whvh18o16    whvh19a14    whvh20l15    whvh20n24    rwhvh10b07    rwhvh10k05    rwhvh10p13    rwhvh11f14    rwhvh11g05    rwhvh12a18    rwhvh12d11    rwhvh1e12    rwhvh1e21    rwhvh1e23    rwhvh1f08    rwhvh1i08    rwhvh1i24    rwhvh1k24    rwhvh1l21    rwhvh2j15    rwhvh2j16    rwhvh3c04    rwhvh3d03    rwhvh3d07    rwhvh3h04    rwhvh4b22    rwhvh4f15    rwhvh4h17    rwhvh4l03    rwhvh6c12    rwhvh6k07    rwhvh6k18    rwhvh6o22    rwhvh8b19    rwhvh8c02    rwhvh8j02    rwhvh9d02    rwhvh9i15    rwhvh13k05    rwhvh13p11    rwhvh14c09    rwhvh14f17    rwhvh14j17    rwhvh14p11    rwhvh15e04    rwhvh15e15    rwhvh15f07    rwhvh15j02    rwhvh15l24    rwhvh16g07    rwhvh17a10    rwhvh17b04    rwhvh17g15    rwhvh17o04    rwhvh18c22    rwhvh18o16    rwhvh19a14    rwhvh20l15    rwhvh20n24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 928
Evalue 2.7238e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1479
TTTTTTTTTTTGCGGTGGCAAAGATGTTTCTCATTATTAATTACCCGAATACATAGTCGACAGATTGTATAATATATTATGTGCATGTGCATATACATAG
CCACCGATTGCATTCACATACGAGCACGCTTTCTCGAGCCATGTTGTTACATGAACATGGACATACACATATTCTTAGGAACAAGTAAGAAAGACAAATG
GAGAAGGAAAACCCAAAGCAATGTCAGAGTTGACAAAACTGCAATGGCACTTTATATGTGGCCCGTGGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCT
CGCAGCCCGGTGGCTTGAAGGCAATGAAGCTGACGCACTGCACCTGGCGCATGTTGTCGAATCCGATGATGCGGACGTACGCGTCAGGGTACTCCTTCTT
GACCTCCTCCACCTCGTTGATCACCTGTGTGGCGTCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTAGCGGCCGTCGTAGTACCCGGGAGAC
GCATTGTGCTCACGGAAGATGAACCCGACCTTGCTGAACTCAAGGCAAGGCACCCACTTGGAGCGGATCAGGTAGTCCACCTGCTTGAGGAGGGCCTCCG
TGCTGAGCGGTGGCAGGTAAGACAGGGTCTCGAACTTCTTGATGCCCTCGATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTGCC
GAGGCTAGCGCCGTTGGAGCGGCGGCTGACGGGGAGGCCGGCGGTGGACTTGAGCCCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCATCACGGTG
GGGGCCATGGCTGTACTATGTAGGTATATAGCTTGCTAGGAGGAGGCG
page-top