Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1473
Contig Information
Length 1678 bp
Tissue Shoot with heat shock treatment
Clones 75 Clones [Download: CSV  ,  FASTA ]
whvh10d01    whvh10h10    whvh11f19    whvh11j19    whvh11n05    whvh12c16    whvh12f15    whvh12p23    whvh1e21    whvh2e08    whvh3i15    whvh3o24    whvh4e03    whvh6k09    whvh6o17    whvh7k13    whvh7m15    whvh8b06    whvh8n19    whvh13g11    whvh13i19    whvh13o16    whvh13p03    whvh14d17    whvh14h07    whvh14k20    whvh15b13    whvh15f08    whvh15f10    whvh15l10    whvh16f02    whvh16l18    whvh17a12    whvh17c14    whvh18d20    whvh18o07    whvh19d03    whvh19e19    whvh19g21    whvh19o01    whvh19o02    rwhvh10d01    rwhvh10h10    rwhvh11f19    rwhvh11n05    rwhvh12c16    rwhvh3i15    rwhvh3o24    rwhvh4e03    rwhvh6j16    rwhvh6k09    rwhvh6o17    rwhvh7k13    rwhvh7m15    rwhvh8b06    rwhvh13g11    rwhvh13i19    rwhvh13m03    rwhvh13o16    rwhvh13p03    rwhvh14d17    rwhvh14h07    rwhvh15f08    rwhvh15f10    rwhvh15l10    rwhvh16l18    rwhvh16m02    rwhvh16m07    rwhvh17a12    rwhvh17c14    rwhvh18d20    rwhvh19d03    rwhvh19e19    rwhvh19o01    rwhvh19o02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic; Short=RuBisCO activase A; Short=RA A; Flags: Precursor >gi|167097|gb|AAA63164.1| ribulose 1,5-bisphosphate carboxylase activase isoform 2 [Hordeum vulgare subsp. vulgare]
Score 1294
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1473
CGGTCATTCATCGCTGATCACCAGCACAGCCGCGCATCCACCGTTGCTAGCAAGGTCGACCAAGCAGCACCGAGATGGCTGCTGCCTTCTCCTCCACCGT
CGGTGCCCCGGCTTCTACGCCGACCAACTTCCTCGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCTCCAAGGCCAAC
AGGTTCACAGTCATGGCAGCGGAAAACATCGACGAGAAGAGGAACACAGACAAGTGGAAGGGTCTTGCCTACGATATCTCCGACGACCAGCAGGACATCA
CCAGAGGGAAGGGCATCGTGGACTCCCTCTTCCAGGCGCCCACGGGCGACGGCACCCACGAGGCCGTCCTCAGCTCCTACGAGTACGTCAGCCAGGGACT
CAAGAAGTACGACTTCGACAACACCATGGGAGGCTTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTCCATCTCTCCAAGAACTTCATGACCCTG
CCCAACATCAAGATCCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAGTGTGAGCTTGTCTTCGCCAAGATGGGCATCAACC
CAATCATGATGAGTGCCGGAGAGCTGGAGAGTGGCAACGCCGGAGAGCCAGCCAAGCTCATCAGGCAGCGGTACCGTGAGGCTGCAGACATGATCAAGAA
GGGTAAGATGTGCTGCCTCTTCATCAACGATCTTGACGCCGGTGCGGGTCGGATGGGCGGGACCACACAGTACACCGTCAACAACCAGATGGTGAACGCC
ACCCTCATGAACATCGCCGATGCCCCCCACCAACGTGCAGCTCCCAGGCATGTACAACAAGGAGGAGAACCCTCGTGTGCCCATCGTCGTCACTGGTAAC
GATTTCTCAACGTTGTACGCCCCTCTCATCCGTGATGGTCGTATGGAGAAGTTCTACTGGGCTCCCACCCGCGACGACCGTATCGGTGTCTGCAAGGGTA
TCTTCCAGACCGACAATGTCAGCGACGAGTCCGTCGTCAAGATCGTCGACACCTTCCCAGGACAATCCATCGACTTTTTCGGTGCTCTGCGTGCTCGGGT
GTACGACGACGAGGTGCGCAAGTGGGTGACCTCTACCGGTATCGAGAACATTGGCAAGAAGCTTGTGAACTCGCGGGACGGACCAGTGACCTTTGAGCAG
CCAAAGATGACAGTCGAGAAGCTGCTAGAGTACGGGCACATGCTCGTCCAGGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACACCTACATGAGCC
AGGCAGCTCTGGGTGATGCTAACCAGGATGCGATGAAGACTGGTTCCTTCTACGGTTAGAACATTCTCCATACACACCCACCATCTCTTGCTGCATAGGA
GGAGGTAAAGGGGCACAGCAAGGTACTTTGCCTGTGCCGGCAGGATGCACCGACCAGACTGCCAAGAACTTCGACCCAACGGCGAGGAGTGACGACGGCA
GCTGCCTTTACACCTTTTAAGCATGCCAATTTAATATCTGATATTTTTATCCTTTGTACCTAAGTACCGCATCGCATCCAAGCGATTGCTGGGCCATGTT
TTGTTAATATATAAAGATATTGAGTATACCTATTTGGTAAAGACAAATAGAACTGCTTATCATTTGTCAAAAAAAAAA
page-top