Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1472
Contig Information
Length 867 bp
Tissue Shoot with heat shock treatment
Clones 75 Clones [Download: CSV  ,  FASTA ]
whvh10f08    whvh10h06    whvh10i16    whvh11b07    whvh11h14    whvh11l18    whvh12e04    whvh12f10    whvh2j24    whvh3n12    whvh3o03    whvh3o04    whvh3p08    whvh4b19    whvh4f04    whvh4j07    whvh4m09    whvh5f17    whvh5f20    whvh7o13    whvh7p05    whvh7p23    whvh7p24    whvh9b21    whvh9c23    whvh9d10    whvh13l24    whvh14j04    whvh14o20    whvh15i06    whvh15m09    whvh16g14    whvh16p07    whvh17k13    whvh17k14    whvh18f07    whvh19l03    whvh20c08    whvh20i08    rwhvh10f08    rwhvh10h06    rwhvh10i16    rwhvh11b07    rwhvh11h14    rwhvh12b07    rwhvh12e04    rwhvh12f10    rwhvh2j24    rwhvh3n12    rwhvh3o03    rwhvh3p08    rwhvh4b19    rwhvh4f04    rwhvh4j07    rwhvh4m09    rwhvh5f17    rwhvh5f20    rwhvh7o13    rwhvh7p23    rwhvh9b21    rwhvh9c23    rwhvh9d10    rwhvh13l24    rwhvh14j04    rwhvh14o20    rwhvh15i06    rwhvh15m09    rwhvh16g14    rwhvh16p07    rwhvh17k13    rwhvh17k14    rwhvh18f07    rwhvh19l03    rwhvh20c08    rwhvh20i08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.96204e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1472
GAGAGAAGAGAGAGAGAGAGAGAGAGTCCTCCTCTCCGCCGATAATACAATACCATGGCCCCCGCCGTGATGGCTTCGTCGGCTACCACCGTCGCACCCT
TCCAGGGGCTCAAGTCCACGGCCGGTCTGCCCGTCAGCCGCCGCTCCAGCGGCAGCCTCGGCAGCGTCAGCAATGGCGGAAGGATCAGGTGCATGCAGGT
GTGGCCGATTGAGGGCATCAAGAAGTTCGAGACCCTGTCTTACTTGCCACCCCTCTCCACGGAGGCCCTCCTGAAGCAGGTCGACTACCTGATCCGCTCC
AAGTGGGTGCCCTGCCTCGAGTTCAGCAAGGTTGGCTTCGTCTTTCGTGAGCACAACAGCTCCCCCGGGTACTACGACGGCCGATACTGGACAATGTGGA
AGCTGCCTATGTTCGGGTGCACCGACGCCACGCAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGCGTCATCGGCTT
CGACAACCTGCGCCAGGTGCAGTGCGTCAGCTTCATCGCATTCAGGCCACCGGGTTGCGAGGAGTCTGGCAAGGCCTAAACTACGAGTTGAAACAATGGC
CTATGTATGATTGTCTTTTGTGAACTTCACTTTTGTCCAGGACTCTGCTTTCCGACCAGAGCATATTTTTCGTTCGGTATGATCTGTGTTTGTACGAACA
TAGGTTGTGGAGCATGCATATGTAAATTCTAGCACCGGCTAGCACATATACAACACCAGTGTGATATTTATTATATACAACAAGCGGACCATTGTCCTGC
TGTTAATTCTCGGAAAACTTTCTTTATTTGGCACTGCAATGGATATGTCTCACAGCTAAAAAAAAAA
page-top