Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1470
Contig Information
Length 844 bp
Tissue Shoot with heat shock treatment
Clones 59 Clones [Download: CSV  ,  FASTA ]
whvh10c22    whvh10i11    whvh11e17    whvh12i13    whvh1a20    whvh3d19    whvh3e14    whvh3k02    whvh6a04    whvh6d22    whvh6m24    whvh7b04    whvh7p14    whvh8c15    whvh8c16    whvh8h22    whvh8o13    whvh9g09    whvh9g14    whvh13d12    whvh14l03    whvh15b05    whvh15b06    whvh16i16    whvh16k24    whvh17f21    whvh19i24    whvh19j11    whvh20a22    whvh20i16    whvh20p11    rwhvh10c22    rwhvh10i11    rwhvh11e17    rwhvh11i11    rwhvh12i13    rwhvh1a20    rwhvh3d19    rwhvh3e14    rwhvh3k02    rwhvh6a04    rwhvh6d22    rwhvh6m24    rwhvh7p14    rwhvh8c15    rwhvh8h22    rwhvh8o13    rwhvh9g09    rwhvh9g14    rwhvh13d12    rwhvh14l03    rwhvh15b05    rwhvh15b06    rwhvh16k24    rwhvh17f21    rwhvh19i24    rwhvh19j11    rwhvh20a22    rwhvh20i16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.88234e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1470
CCTCGTGCCGATCCTCCTCTCCTCCAGATAATACATTACCATGGCCCCCGCCGTGATGGCTTCCTCGGCTACCACCGTCGCACCCTTCCAGGGGCTCAAG
TCCACAGCCGGTCTCCCCGTCGGCCGCCGCTCCAGCGGCAGCCTCAGCAGCGTCAGCAATGGCGGAAGGATCAGGTGCATGCAGGTGTGGCCAATTGAGG
GCATCAAGAAGTTCGAGACCCTGTCTTACCTGCCACCCCTATCCACGGAGGCCCTCCTGAAACAGGTCGACTACCTGATCCGCTCAAAGTGGGTGCCCTG
CCTCGAGTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCCCCCGGGTACTACGACGGCCGATACTGGACAATGTGGAAGCTGCCTATGTTC
GGGTGCACTGACGCCACACAGGTGCTGAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGTGTCATCGGCTTCGACAACCTGCGCC
AGGTGCAGTGCGTCAGCTTCATCGCCTTTAGGCCACCGGGTTGCGAGGAGTCCGGCAAGGCCTAAACTACGAGTTGAAACAATGGCCTATCTCGTATGAA
GGTCTTTTGTGAACTTCACTTTTGTCCAAAACTCTGCTGTACGACTCTGCTTTCTGACCGGAGCATACCTTTTGTTCTATATGATTTTGTGTATGTATGT
ACGAACATAGGTTCTTGAGCATGCATACGTAATTCCTCATAGGTCTATATCTTCTTCTTCGGCACAACCCCCGAATACATCAATGGACGAGATCTGTCTA
TACCTTTTCATAATAAAGAGTAGGATGGTCTTTCAAAAAAAAAA
page-top