Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1469
Contig Information
Length 971 bp
Tissue Shoot with heat shock treatment
Clones 54 Clones [Download: CSV  ,  FASTA ]
whvh10a20    whvh10j14    whvh12l22    whvh1c14    whvh1h19    whvh1h20    whvh2f13    whvh2g07    whvh2o02    whvh2o21    whvh2p04    whvh4j09    whvh5b11    whvh5m22    whvh6c05    whvh6h09    whvh6j16    whvh8e13    whvh8m05    whvh13d05    whvh13o20    whvh15e09    whvh17e21    whvh17f24    whvh18c06    rwhvh10a20    rwhvh10b13    rwhvh10j14    rwhvh12o22    rwhvh1c14    rwhvh1h19    rwhvh1h20    rwhvh2f13    rwhvh2g07    rwhvh2o02    rwhvh2o21    rwhvh2p04    rwhvh4g15    rwhvh4j09    rwhvh5b11    rwhvh5m22    rwhvh6c05    rwhvh6f15    rwhvh8e13    rwhvh9j10    rwhvh13d05    rwhvh13o20    rwhvh15d02    rwhvh15e09    rwhvh17e21    rwhvh17f24    rwhvh17h18    rwhvh18c06    rwhvh19g01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PW9, chloroplastic; Short=RuBisCO small subunit PW9; Flags: Precursor >gi|170771|gb|AAA34302.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 867
Evalue 4.03059e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1469
ATACACAACATATGATTGAGCAAAAAATGCATGAGAAGAAAACAATGCAAGACATAGGCATTTCCGGCTGCAAACAAACCAACCTTTCCATCGATTGATG
GCAAGACACTAATGCGTTGATTGCATATAATATATATGTATATGTATAGCCGGTGCTATAATTCTCATATGCATCCTCCTCGACCTACATTGGTAGGTGC
TTACATACATATGCTCATATATTCACATATATATGAGTAGAACGAGAAGTAAAACTGAGAAAGCAGAGCCGCCGACAAATGTGACTAACATGACATGTAT
ATCGGTTACTTCAACTTGCACTTTAGGCCTTGCCGGATTCCTCGCAACCTGGTGGCCTGAAGGCAATGAAGCTGACGCATTGCACCTGGCGCATGTTGTC
GAAGCCGATGACGCGGACATAGGCATCAGGGTACTCCTTCTTAACCTCCTCGACCTCGTTGAGCACCTGTGTGGCATCGGTGCAGCCGAACATAGGCAGC
TTCCACATTGTCCAGTATCGACCGTCGTAGTACCCGGGGGAGCTGTTGTGCTCACGGAAGACGAAGCCAACCTTGCTGAACTCGAGGCAGGGTACCCACT
TGGAGCGGATCAAGTAGTCGACCTGCTTTAGGAGGGCCTCCGTAGAGAGGGGTGGCAAGTAAGACAGGGTCTCGAACTTCTTGATGCCCTCAATTGGCCA
CACCTGCATGCATCTTATCCTTCCGCCATTGCTGACGCTGCTGAGGCCGGCGCTGCCGGAGCGGCGGCTGACGGGGAGGCCCGCGGTCGACTTGAGCCCC
TGGAAGGGCGCGACGGTGGTGGCGGAGGAAGCCATCATGGCGGGAGCCATGGCGGAGTACGTGAATTGCTAGGTGGGGAGGCGATAGCGGCACGAGGCCT
CGTGCCGAATTCGGCACGAGGGTTGCAACAGCTAAATTAGGCTACAATGGCTCTGAGGCTGTGGGCAAGCT
page-top