Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1467
Contig Information
Length 847 bp
Tissue Shoot with heat shock treatment
Clones 48 Clones [Download: CSV  ,  FASTA ]
whvh10d10    whvh11o18    whvh12b07    whvh2f02    whvh2i15    whvh3m12    whvh6d11    whvh7e22    whvh9b12    whvh9h11    whvh13o01    whvh14l01    whvh15e13    whvh15k21    whvh17a06    whvh18a04    whvh18a15    whvh18a16    whvh19e10    whvh19l20    whvh19n01    whvh19n02    whvh20g09    whvh20i20    rwhvh10d10    rwhvh11o18    rwhvh2f02    rwhvh2i15    rwhvh3m12    rwhvh6d11    rwhvh7e22    rwhvh9b12    rwhvh9h11    rwhvh13o01    rwhvh14l01    rwhvh15e13    rwhvh15k10    rwhvh15k21    rwhvh17a06    rwhvh18a04    rwhvh18a15    rwhvh18a16    rwhvh18n01    rwhvh19e10    rwhvh19l20    rwhvh19n01    rwhvh20g09    rwhvh20i20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.89506e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1467
GCGGCATCCTCCTCTCCTCCGATAATACAATACCATGGCCCCCGCCGTGATGGCTTCGTCGGCTACCACCGTCGCACCCTTCCAGGGGCTCAAGTCCACA
GCCGGTCTGCCCGTCAGCCGCCGCTCCAGCGGCAGCCTCGGCCGCGTCAGCAATGGCGGAAGGATCAGGTGCATGCAGGTGTGGCCGATTGAGGGTATCA
AGAAGTTCGAGACCCTGTCTTACTTGCCACCCCTCTCCACAGAGGCCCTCCTAAAGCAGGTAGACTACCTGATCCGCTCCAAGTGGGTGCCCTGCCTCGA
GTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCTCCCGGATACTACGACGGTCGATACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGC
ACCGACGCCACGCAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGATGCCTATGTCCGTGTCATCGGCTTCGACAACCTGCGCCAGGTGC
AGTGCGTCAGCTTCATCGCCTTCAGGCCACCAGGTTGCGAGGAGTCCGGCAAGGCCTAAACTACAAGTTGAAACAATGGCCTATGTATGATGGTCATTTG
TGAACTTCACTTTTGTCCACGACTCTGCTTTCCGACCAGAGCATATTTCTCGTTCCATATGATCTGTGTTTGTACGAACATAGGTTGTGGAGCATGCATA
TGTAAATTCTAGCGAAAAATCTATACTGAAGTCGAGAGGGGCTCGGGGCTCCGCTGCTAACCCTACCCGCTCCCTTGTGCCGCCGCCGCGCTGCATCAGA
GCGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAANNCNAAAAAAAAA
page-top