Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1462
Contig Information
Length 822 bp
Tissue Shoot with heat shock treatment
Clones 39 Clones [Download: CSV  ,  FASTA ]
whvh10c10    whvh10p10    whvh1m23    whvh1o14    whvh2b23    whvh2c14    whvh2p15    whvh9g02    whvh13p02    whvh14i10    whvh16d06    whvh16i05    whvh16k16    whvh17c12    whvh17i23    whvh19b10    whvh19b21    rwhvh10c10    rwhvh10p10    rwhvh12m07    rwhvh1o14    rwhvh2b23    rwhvh2c14    rwhvh2m01    rwhvh2p15    rwhvh7l03    rwhvh9g02    rwhvh13p02    rwhvh14i10    rwhvh16d06    rwhvh16i05    rwhvh16j14    rwhvh16k16    rwhvh17c12    rwhvh17c23    rwhvh17i23    rwhvh19b10    rwhvh19b21    rwhvh20n12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum]
Score 847
Evalue 6.31834e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1462
TTTTTTTGCAGTGCCAAATAAAGAAACTTTTCCATGAATTAATAACATCAAGACAATGGTCCGCATGTTTTATATAATAAATATCACACAGGTTTTGTAT
ATGTGTAGCCGGCTCTAGAATTTACATATGCATGCTCGAGAATCTATGTTCGTACATACATACACAGACCATATAGAATGAAAAATATGCTCTGGTCGTC
CAGCAGAGTCGTGGACAAAAGTGAAGTTCACAAAAGACCTTCATACATAGGCCATTGTTTCAACTCGTAGTTTAGGCCTTGCCAGACTCCTCGCAACCCG
GTGGCCTGAAGGCAATGAAGCTGACGCACTGCACCTGGCGTAGGTTGTCGAAGCCGATGACGCGGACATAGGCGTCAGGGTACTCCTTCTTGACCTCCTC
CACCTCGTTGAGCACCTGTGTAGCGTCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTATCGACCATCGTAGTACCCGGGGGAGCTGTTGTGC
TCACGGAAAACGAAGCCAACCTTGCTGAACTCGAGGCAGGGCACCCACTTGGAGCGGATCAAGTAGTCGACCTGCTTCAGGAGGGCCTCCGTGGAGAGGG
GTGGCAAGTAAGACAGAGTCTCGAACTTCTTGATGCCCTCAATCGGCCACACCTGCATGCACCTGATCCTTCCGCCGTTGCTGACGCTGCTGAGGCCGGC
GCTGCTGGAGCGGCGGCTGACGGGCAGGCCGGCGGTCGACTTGAGACCCTGGAAGGGTGCGACGGAGGTGGCCGAGGAAGCCATCACAGTGGGGGCCATG
GTGTTGGAGGAGAGAAGGTGGC
page-top