Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1461
Contig Information
Length 854 bp
Tissue Shoot with heat shock treatment
Clones 38 Clones [Download: CSV  ,  FASTA ]
whvh10c23    whvh10l05    whvh11g04    whvh11j16    whvh12h01    whvh1b09    whvh1d21    whvh3c23    whvh5i11    whvh7e01    whvh9d16    whvh14a15    whvh14h11    whvh15f06    whvh17m03    whvh18d06    whvh19c06    whvh20m01    rwhvh10c23    rwhvh10l05    rwhvh11g04    rwhvh11j16    rwhvh12h01    rwhvh12i03    rwhvh1b09    rwhvh1d21    rwhvh1d24    rwhvh3c23    rwhvh5i11    rwhvh7e01    rwhvh9d16    rwhvh14a15    rwhvh14h11    rwhvh15f06    rwhvh17m03    rwhvh19a09    rwhvh19c06    rwhvh20m01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.9205e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1461
TTTTTTTGCGGGAAAAAAGAATTAATAACAGCAAGACAATGGTCCGCGTGTTGTATATAACAAATATTACACAGGTTTTGCATATGGATAGCCGGTGTAT
ATAGACCTATGAGGAATTATGTATGCATGCTCGAGAACATAGGTTCCTACATACATACACAAATCATATAGAACAAAAGGTATGCTCCGGTCGGAAAGCA
GAGTCGTGCAACAGAGGTCGTGGACAAAAGTGAAGTTCACAAAAGATCTTCATATGAGATAGGCCATTGTTTCAACTCATAGTTTAGGCCTTGCCGGACT
CCTCGCAACCCGGTGGCCTGAAGGCGATGAAGCTGACGCACTGCACCTGGCGCAGGTTGTCGAAGCCGATGACGCGGACATAGGCGTCAGGGTACTCCTT
CTTGACCTCCTCCACCTCGTTGAGCACCTGTGTGGCGTCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTATCGACCGTCGTAGTACCCGGGA
GAGCTGTTGTGCTCACGGAAGACGAAGCCAACCTTGCTGAACTCGAGGCAGGGCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTCAGGAGGGCTT
CCGTGGAGAGGGGTGGCAAGTAAGACAGGGTCTCAAACTTCTTGATGCCCTCAATTGGCCACACCTGCATGCACCTGATCCTTCCGCCGTTGCTGACGCT
GCCGAGGCTGCCGCTGGAGCGGCGGCTGACGGGCAGGCCGGCTGTGGACTTGAGACCCTGGAAGGGTGCGACGGTGGTAGCCGACGAAGCCATCACGGCG
GGGGCCATGGTATTTGTATTATCGGAGGAGAGGAGGATGCCCTCGTGCCGAATT
page-top