Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1455
Contig Information
Length 1515 bp
Tissue Shoot with heat shock treatment
Clones 33 Clones [Download: CSV  ,  FASTA ]
whvh10b02    whvh2k24    whvh2p14    whvh6e22    whvh7c14    whvh7h14    whvh8o02    whvh9o10    whvh14d19    whvh16l16    whvh18p10    whvh19k01    whvh19o21    whvh20b08    whvh20f08    whvh20l05    rwhvh10b02    rwhvh10f06    rwhvh2k24    rwhvh2p14    rwhvh6e22    rwhvh7c14    rwhvh7f16    rwhvh7h14    rwhvh8o02    rwhvh9o10    rwhvh14d19    rwhvh16l16    rwhvh18p10    rwhvh19k01    rwhvh19o21    rwhvh20b08    rwhvh20l05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Phosphoribulokinase, chloroplastic; Short=PRKase; Short=PRK; AltName: Full=Phosphopentokinase; Flags: Precursor >gi|100839|pir||S15743 phosphoribulokinase (EC 2.7.1.19) - wheat >gi|5924030|emb|CAB56544.1| phosphoribulokinase [Triticum aestivum]
Score 945
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1455
GCAGCACATGGTATTTTCTGCATTGAAACATGGGAGAAGATGTACATCGAAATTTGTTAAGAAGAGACATAAGAGACCCTCATCATGGAGAGGATTTTCG
AGAAGTTCAAAATGCAGGTTTTCATGAGTTCTGCAGTGAACTTTCTACCGTCTTCTAGCTGTAATATATTCAAACTAGGTACAAGAAATGCGAGGATGCT
CATTCTCATTGAGTTGGTGATGAAATGATTCGTGAACTTGAATTTGGGGCTCATCAAACTTTTGCTGCTTCAGCAGGAACGCCGGCCCTCTCAGCGATGA
TCTGTTCATAGAGATCTCTAATCTTCAGTCCTACAATGGTCTGGAAGAGACCTGTTCCATTGTTGCTGCCTGGGAAGTCTGCATGCTTTAGCATTTGCTG
TGTCACCTCCCCGTAGAACTTGGTTGAGAGGTTGCTTAGGTGGCTCTCAACATAGATGAGTTCATCTAGTCTGTCAAATTGCCCATCCATCTCCAGCACC
GATACCTCTTGGCCAAAGTAAGTGTCTGGGCCATAGGAAAATTTGATGCCAGGATAAGAGCATGTAAGCTTTCTTCCACAAGGGATCCAGTTGATGGTTG
ATCCTTCATCGAAGAGGTAAACCGGGTTGAAGAACTTAATGCCTTCTTTCATGATCAATTTAACTCGCAGCACCTTTCCTTCGTTGTCATCAGGAATCAG
CTGGGTTGGCAGAACTTCAATCACAGCATCAGCGTATTGCTTCTGCGGATCAATAAAGGCATCAAAATCAGGTTTCCTGGCTTCGATGCTAGCCTTGATG
CTTTCAAGACTGTGCCCACGCTCTGCCCATGTCTCTCTGAATTTTCCATGCGAACTTAACCTCATTGCTGATGTCTAAGTAGATGCTGAAATCAAGGAGC
TCCCTCACACGTTCATCGTACATTGGGGTGCAAACCCTCGATGACGAAGATCTTGGGGGGCTGGATGAGCTCCGCCGGGTCGAGGAGGCCAGTGACGTGG
TTGTAGATTGGCTTCTCAATAGCCTTGCCTTCCTTGATTGCCTTCACCTGCTCATACATGAGATCAAAGTCGTTTGCCTTGGGGTCCAGGGCGGTCACAC
CTTTCTCCTTCCTCCCGGTTCTGTCCAAGGAATGGTAGTCATCAAGGCATATGACCGTCGTCGTGTCGCTGATGAGCGTGTTGGAGTCTGGGTTGCCGCC
CTTGGGTGGCTCTGCAGCACCTCCAAACACGCTTGTGAGCCGGCGCATGAAGGTGGATTTCCCACATCCCGAGTCTGCTGCCAGGCCAATCACTATTGGC
TGCTCAACTGCGCATGAGACCTGGAAGGTCCTTGCCCCATGCCTCGTGTTACTCCTCCTGCTGCTTCTGGTCGTGAAGAGGATGACTTGGTTCTGCCTGA
AGCCAGAGTTTGGGATGGTGGTGCATGGGGAGCGCAGGGATGTGGTGCTGTGTGGGCTGCAGAATGCCATGTTTGCTGCCCAACCTCTTGGAGCTGCTCT
TCTCCCCTTCAAGCC
page-top