Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1453
Contig Information
Length 1070 bp
Tissue Shoot with heat shock treatment
Clones 30 Clones [Download: CSV  ,  FASTA ]
whvh10g10    whvh10p02    whvh2h10    whvh3d18    whvh4a08    whvh6o06    whvh8g05    whvh14i21    whvh15i22    whvh16h21    whvh16l20    whvh16m14    whvh17k02    whvh17n12    whvh17n24    rwhvh10g10    rwhvh10p02    rwhvh2h10    rwhvh3d18    rwhvh4a08    rwhvh6o06    rwhvh8g05    rwhvh9f04    rwhvh14i21    rwhvh15i22    rwhvh16h21    rwhvh16l20    rwhvh16m14    rwhvh17k02    rwhvh17n12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0592500 [Oryza sativa (japonica cultivar-group)] >gi|122246902|sp|Q10HD0|CB23_ORYSJ RecName: Full=Chlorophyll a-b binding protein, chloroplastic; AltName: Full=LHCII type I CAB; Short=LHCP; Flags: Precursor >gi|152013384|sp|A2XJ35|CB23_ORYSI RecName: Full=Chlorophyll a-b binding protein, chloroplastic; AltName: Full=LHCII type I CAB; Short=LHCP; Flags: Precursor >gi|50839002|gb|AAT81763.1| chlorophyll a/b binding protein [Oryza sativa (japonica cultivar-group)] >gi|108709618|gb|ABF97413.1| Chlorophyll a-b binding protein, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549057|dbj|BAF12500.1| Os03g0592500 [Oryza sativa (japonica cultivar-group)] >gi|125544706|gb|EAY90845.1| hypothetical protein OsI_12453 [Oryza sativa Indica Group] >gi|125586998|gb|EAZ27662.1| hypothetical protein OsJ_011145 [Oryza sativa (japonica cultivar-group)]
Score 1252
Evalue 1.06722e-135
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1453
ATCCACCAGTTCATCTCACTGAGCTCGCAGGCAGCCCCAGCCACCAGCGAAATGGCCGCGTCGGCGCTGCACCAGACGACCAGCTTCCTCGGCACCGCCC
CGCGCCGCGATGACCTCGTCCGCAGCGTCGGCGACTTCGGCGGCCGCATCACCATGCGCCGGACCGTCAAGAGCGCGCCCCAGAGCATCTGGTACGGCCC
AGACCGTCCCAAGTACCTGGGCCCGTTCTCCGAGCAGACCCCGTCGTACCTGACCGGCGAGTTCCCCGGCGACTACGGGTGGGACACCGCCGGATTGTCT
GCTGACCCCGAGACGTTCGCCAAGAACAGGGAGCTGGAGGTGATCCACTCGCGGTGGGCGATGCTCGGCGCCCTGGGGTGCGTGTTCCCGGAGATCCTGT
CCAAGAACGGCATCAAGTTCGGCGAGGCCGTGTGGTTCAAGGCCGGCGTCCAGATCTTCTCCGAGGGCGGCCTCGACTACCTGGGCAACCCCAACCTGGT
GCACGCGCAGAGCATCCTCGCCATCTGGGCGGTGCAGGTGGTGCTCATGGGCTTCATCGAGGGCTACCGTGTTGGTGGCGGCCCCCTCGGCGAGGGCCTC
GACATCATCTACCCAGGAGGCGCCTTCGACCCGCTTGGCCTCGCCGACGACCCCGACACCGCCGCCGAGCTCAAGGTGAAGGAGCTCAAGAACGGCCGCC
TCGCCATGTTCTCCATGTTCGGCTTCTTCGTGCAGGCCATCGTCACCGGGAAGGGGCCAGTTGAGAACCTCTTCGACCACGTCGCCGACCCGGTCAACAA
CAACGCCTGGGCCTTCGCCACCAACTTCGCCCCCGGAAGCTAAATGTGTTTAGCCGTCCGTCCGTCCGTCCGTCCATCGGACGAGATATGCATGTGTACT
TGTACGTCGTGGATCAACGTGTAGCTGCACGTACTTTGTGTGTTTATTTGTACCATGATCGAGCGAGCGAGAGGTCCTCTCGCTAGCTGCGCGCAATGTA
AATTAATTAAGCACAAGGTGTGCACGAGGGAATGGATGGAAGAATCGTGTGTCATTACTCAAAAAAAAAA
page-top