Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1450
Contig Information
Length 3458 bp
Tissue Shoot with heat shock treatment
Clones 30 Clones [Download: CSV  ,  FASTA ]
whvh10f02    whvh11o09    whvh11p11    whvh2b01    whvh2i24    whvh2k10    whvh2m01    whvh4o19    whvh6n14    whvh7k08    whvh8b16    whvh8n17    whvh9p21    whvh13f13    whvh16n23    whvh17a04    whvh18p14    whvh20n17    rwhvh10f02    rwhvh2b01    rwhvh2i24    rwhvh2k10    rwhvh4o19    rwhvh7k08    rwhvh13f13    rwhvh15p06    rwhvh16n23    rwhvh17a04    rwhvh18p14    rwhvh20n17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Aurantimonas sp. SI85-9A1] >gi|90336396|gb|EAS50137.1| conserved hypothetical protein [Aurantimonas sp. SI85-9A1]
Score 404
Evalue 1.90372e-43
Total Hit Count 295
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1450
CCCGGGCATTGAGAAGGAAGGACGCTTTCAGAGGCGAAAGGCCATGGGGAGAGATTTTTCTGTGATCCATGGATCTCCGATCGGGAAACCGTATCCAAGC
TCCGTGGCTAGTCTGCGCTCTTTGGACTTTTCAAACTTAGCGAACTGAAACATCTGAGTAGCTAAAGGAAGGAAAATCAACCGAGACCCCGTTAGTAGCG
GCGAGCGAGAGCGGAACAAGGGTTTTCATCAAAAGAAATCCGAAGCGGTTTCATTCGATTTGTTGTGGATTGGATGATGGAAAAACCAGCAAGCAGCAAG
CGTAGTTAGAAAAGTTGCCGTAGCGCGCCCTACGGAGTTGTACAAAGTCAGCAACCGTTTTGGGGCGCAAGCATAGGCAACACAGGACTGATGACGGGGT
GGGGCGCGCAGTGAACTGGTTTTCTAAAAAGATTGGAAGATCCGGCCAAAGAAGGTGATAGCCCTGTTCATTCGTTCCCATGGTTCGATCCTTCCCAGTA
AAACGCGGCGTGTTCGAATGATGATCGCTTTTACGCGAGAAAGGGGGACCACCCTCTAAGCCTAAGTATTCCTCAATGACCGATAGCGTACAAGTACCGT
GAGGGAAAGGTGAAAAGAACCCCAATCGGGGAGTGCAATAGAGAACCTGAGATCCGATGCGAACAATCAGTCGAAGGAGCGGAGCGCGGGCGCACTCACT
CTAACGGCGTACCTTTCGCATGATGGGTCAGCGAGGAAATGGGAACAGCGGCTTAAGCCATTAGGTGTAGGCGCTTTCCAGAGGTGGAAGATTTACGTTC
TTCCTATTTGACCCGAAACCGATCGATCTAGCCATGAGCAGGTTGAAGAGAGCTCTAACAGGCCTTGGAGGACCGAACCCACGTATGTGGCAAAATACGG
GGATGACTTGTGGCTAGGGGTGAAAGGCCAACCAAGATCGGATATAGCTGGTTTTCCGCGAAATCTATTTCAGTAGAGCGTATGATGTCGATGGCCCGAG
GTAGAGCACTCAATGGGCTAGGGTGGCCCCCATTTCGCTTTACCAACCCCAGGGAAACTCCGAATACAGGCCGTCATCCTTAGTACAGACAGACTGATTG
GGTGCTAAGATCCAAAGTCGAGAGGGAAACAGCCCAGATCGTACGCTAAGGTCCCTAAGCAATCACTTAGTGGAAAAGGAAGTGATCGAGCGATGACAAC
CAGGAGGTGGGCTTGGAAGCAGCCATCCTTTGAAGAAAGCGTAATAGCTCACTGGTCTAGCTCCATGGCACCGAAAATGTCTCAGGGCTCAAGTGATTCA
CCGAAGCGACGAGACCTTGAAAGCAGCTTTTTCAAGTGTCAGTAGCGGGACGTTCTGTCAATCGGGGAAGGTTTTTGGTGACAAGACCTGGAGATATCAG
AAGTGAGAATGCTGACATGAGTAACGAGAAATCCTGTGAAAAACACGATCGCCTGCCAGTGGAAGGCTTTCTGCGTTCAGTCAATCTACGCAGAGTGAAT
CGGTCCCTAAGGAACCCCCGAAAGGGCTGCCGTCCGATGGGTACACGAAAGTGACGAAGTTGCTTTGACTACTGAACCATGCCTGGATCGTCGGAGCGAA
TTGGATGATCGGGCCGAGGGCTGCCCCCTCTTCCCCTCGCTCTCCTTTCCTTAATATTCACCGTCGAGTCATCAAAGCCGTCAACTAATTCAGAGGGGCT
CGGCTGGCCCGGTCGCCCTACGCTACTGGCGCTTCCAAAGGCGAAGCTCTCGTCTTTGGCGACCAGCCAAACGGAGGGCTAAAACCTGTAGTTTTGAAGC
AAGGGATGAGCGCGAAAGCCGTTGCGCTTCCGTACACGCGCATACGTTTTCTTGCTGGGGCGGACACGGATTTCTCTCTAAAGGCGAAGAAAAAGAAGTG
GGCGAACACTCGGCCCAGCGGGCGAACATGCCGGCTCCGGCTCCGCGCACCTGCTGACACCTTTCGAAGCACTTTCACGTGTGAACCGAAGTCGTCTTGC
CGAACTCCTTCCTTTCTCATTTCAGGTCCTCGCCTTTTTCATCTTCCGTAGGGGCCTTTAGTCTTTTGATTAGAGTGGAGGTCGCGAGAGAGCAGAGCGT
ACCGCCCTGCCATAGTCGCGAGGATCTTAATAGTCGGTCGCGACTGTTGTCATAGTCAACGACGGTTGAAACTTCCAGGAAAAAACTTCGAATTGGGAGG
GCGATCCTCCCGGTGAACTGACCGTACCCCAAACCGACACAGGTGAACAAGTAGAGTATACTAGGGCGCGTCGAGAGAACCATGTCGAAGGAACTCGGCA
AAATGACCCCGTAACTTCGGGAGAAGGGGTGCTCTCCTATCTTTTGATTAGGAAAGCGGCACATACCAGGGGGTAGCGACTGTTTATTAAAAACACAGGA
CTCTGCTAAGTGGTAACACGATGTATAGAGTCTGACACCTGCCCGGTGCTGGAAGGTCGGAAGGAGAAGTGTGATAAGCTTTGAATGGAAGCCCCGGTAA
ACGGCGGCAGTAACTCTAACTGTCCTAAGGTAGCGAAATTCCTTGTCGCATAAGTAGCGACCTGCACGAATGGTGTAACGACTGCCCCGCTGTCTCCGAC
ATGGACCCGGTGAAATTGAATTCTCCGTGAAGATGCGGAGTACCAACGGCTAGACGGTAAGACCCCGTGCACCTTGACTATAGCTTCGCAGTGACAACCT
TGATCGAATGTGTAGGATAGGTGGGAGGTGGTGACACACAACGACCAATCCTGAAAGACCACTCTTTCGTCTAAGGATGCCTAACCGCCGCACCGATCAT
TCGGGGGGGGCGGGACACTGCGAGGTGGGTAGTTTATCTGGGGCGGATGCCTCCTAAAGAGTAACGGAGGTGTGCGAAGGTAGGCTCAAGCGTTGATTCT
GCTCGTGAGCGTAATGGTATAAGCCTGCCTGACTGTGAGACCGACTGGTCGAACAGAGACGAAAGTCGGCCATAGTGATCCGGGAGTCCCGTGTGGAAGG
GCTCTCGCTCAACGGATCAAAGGTACGCCGGGGATAACAGGCTGATGACTCCCAAGAGCTCTTATCGACGGAGTCGTTTGGCACCTCGATGTCGACTCAT
CACATCCTGGGGTTGAAGAAGGTCCCAAGGGTTCGGTTGTTCGCCGATGAAAGTGGTACGTGAGTTGGGTTTAGAACGTCGTGAGACAGTTCGGTTCCTA
TCTACCGTTGGTGTTAAAGGGAGAACTGCGAGGAGCCAGCCCTAGTACGAGAGGACTGGGCTGGGTCAACCTATGGTGTACCGGTTGTTATGCCAATAGC
AGCGCCGGGCAGCTAAGTTGGTATGGAAGAACTGCTGCGCCGCGGGAAATCCTTCTCTATACAAGTTCTCGTACGAGGTTTTTGAACAGAACTTCGATAG
GCGAGAGGTGTAAGCACCGCGAGGTGTGAAGCGATCTCGTACTAAACGAAAAAAAAAA
page-top