Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1444
Contig Information
Length 851 bp
Tissue Shoot with heat shock treatment
Clones 26 Clones [Download: CSV  ,  FASTA ]
whvh10g08    whvh10g23    whvh3l01    whvh4k21    whvh5c05    whvh7g16    whvh9h20    whvh13c23    whvh13n13    whvh15h19    whvh18o04    whvh20i24    whvh20j19    rwhvh10g08    rwhvh10g23    rwhvh3l01    rwhvh4k21    rwhvh5c05    rwhvh7g16    rwhvh9h20    rwhvh13c23    rwhvh13n13    rwhvh15h19    rwhvh18o04    rwhvh20f08    rwhvh20j19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PW9, chloroplastic; Short=RuBisCO small subunit PW9; Flags: Precursor >gi|170771|gb|AAA34302.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 860
Evalue 2.10441e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1444
CCTCGTGCCGGGCCTAGCTAGCTATCGCCTCCCCACCTAGCAATTTACGTACTCCGCCATGGCCCCAGCCGTGATGGCTTCTTCCGCCACCACCGTCGCG
CCCTTCCAGGGGCTCAAGTCGACCGCCGGCCTCCCCATCAGCTGCCGCTCCGGCAGCACCGGCCTCAGCAGCGTCAGCAATGGCGGAAGGATCAGATGCA
TGCAGGTGTGGCCAATTGAGGGCATCAAGAAGTTCGAGACCCTGTCTTACTTGCCACCCCTCTCCACGGAGGCCCTCTTGAAGCAGGTCGACTACTTGAT
CCGCTCCAAGTGGGTGCCCTGCCTCGAGTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCCCCCGGGTACTACGACGGTCGATACTGGACA
ATGTGGAAGCTGCCTATGTTCGGGTGCACCGACGCCACACAGGTGCTCAACGAGGTGGAGGAGGTTAAGAAGGAGTACCCTGATGCGTATGTCCGCGTCA
TCGGCTTCGACAACATGCGCCAGGTGCAATGCGTCAGCTTCATTGCCTTCAGGCCACCAGGCTGCGAGGAATCCGGCAAGGCCTAAAGTGCAAGTTGAAG
TAACCGATATACATGTCATGTTAGTCAAATTTGTCGGCGGCTCTGCTTTCTCAGTTTTACTTCTCGTTCTACTCATATGTGAATATATGAGCATATGTAT
GTAAGCACCTACCAATGTAGGTCGAGGAGGATGCATATGAGAATTATAGCACCGGCTATACATATACATATATATTATATGCAATCAACGGATTAGTGTC
TTGCCGTCAATTGATGGAAATGTTACTTTCTTTGCAGCCGGAAAAAAAAAA
page-top