Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1441
Contig Information
Length 2033 bp
Tissue Shoot with heat shock treatment
Clones 24 Clones [Download: CSV  ,  FASTA ]
whvh10c16    whvh10d03    whvh10l09    whvh10n03    whvh2a07    whvh3j01    whvh5a24    whvh5c16    whvh9i06    whvh9l18    whvh16g15    whvh16n05    whvh19h24    rwhvh10c16    rwhvh10d03    rwhvh10l09    rwhvh10n03    rwhvh2a07    rwhvh3j01    rwhvh5a24    rwhvh9i06    rwhvh9l18    rwhvh16n05    rwhvh19h24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0277500 [Oryza sativa (japonica cultivar-group)] >gi|77554291|gb|ABA97087.1| RuBisCO subunit binding-protein alpha subunit, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649074|dbj|BAF29586.1| Os12g0277500 [Oryza sativa (japonica cultivar-group)] >gi|125536273|gb|EAY82761.1| hypothetical protein OsI_37967 [Oryza sativa Indica Group]
Score 2477
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1441
TCACTCCCTCCCCCTCCCCTGCCTCCACCTTATCCTCACCTCAGCTCAGCTCACCAGCTCGCCCCCCCGCCTCCAATGGCGTCGGCCAACGCCATCTCCA
CCGCCTCCCTCCTCCGCTCCTTCTCCTCCCAGGGGAGGCCGAGGAGGTCCAAGAACGGCCGCTCCTCGCGGCTGGTGGTGCGCGCGGACGCCAAGGAAAT
CGCCTTCGACCAGAAGTCCCGCGCCGCGCTCCAGGCCGGTGTCGAGAAGCTCGCCAGCGCCGTCGGCGTCACCCTCGGCCCGCGAGGGAGGAACGTAGTG
CTGGATGAGTATGGCAACCCCAAAGTGGTGAATGATGGTGTTACCATTGCCCGTGCTATTGAGCTAGCTAACCCAATGGAAAATGCCGGTGCAGCTCTGA
TTCGTGAGGTTGCTAGCAAGACCAATGATTCTGCTGGTGATGGGACTACAACCGCTTGTGTTCTTGCCCGGGAAATCATCAAGCTGGGTATTTTGAGTGT
AACTTCTGGTGCAAACCCTGTATCGCTTAAGAAAGGAATAGACAAAACTGTCCAGGGTTTGATTGAAGAGCTTGAAAGGAAAGCTAGACCAGTCAAGGGC
AGTGGTGACATCAAAGCTGTTGCCTCTATCTCTGCTGGTAACGATGAACTAATTGGAGCCATGATTGCGGATGCAATTGACAAAGTGGGTCCAGATGGTG
TCCTTTCGATCGAGTCGTCTTCATCTTTTGAGACTACTGTTGATGTTGAAGAAGGAATGGAGATTGACCGAGGCTACATTTCCCCTCAATTTGTGACAAA
CCTTGAGAAATCAATTGTGGAGTTTGAGAACGCCAGAGTTCTTATAACTGATCAGAAGATCACAAGCATAAAGGAAATCATTCCACTTCTGGAGCAGACT
ACACAGTTGAGATGCCCGCTGTTTATTGTAGCTGAGGACATCACTGGTGAAGCTTTGGCAACTCTTGTTGTTAACAAGCTCAGAGGTATTATTAATGTTG
CGGCGATCAAAGCCCCAAGTTTCGGTGAGCGGCGGAAGGCTGTCCTTCAGGATATTGCCATCGTGACAGGCGCTGAGTACCTAGCGAAGGATCTTGGTCT
GTTGGTTGAGAATGCAACAGTAGACCAACTTGGGACAGCAAGGAAAATCACAATTCATCAGACTACAACCACCCTCATAGCAGATGCAGCTAGCAAAGAC
GAGATCCAGGCCAGGGTTGCACAGCTAAAGAAGGAGCTTTCTGAAACGGATTCCATCTATGACTCTGAGAAATTGGCTGAGAGGATTGCCAAGCTTTCTG
GTGGTGTGGCCGTCATCAAGGTTGGAGCAACAACCGAGACAGAGCTCGAGGACCGTCAGCTGCGTATCGAGGACGCGAAGAATGCCACTTTTGCAGCCAT
CGAGGAGGGCATTGTTCCCGGTGGTGGCGCGGCGTATGTGCACCTGTCTACTTACGTCCCTGCGATCAAAGAAACCATCGAAGACCATGATGAGCGCCTT
GGTGCCGACATCATCCAGAAGGCATTGCAAGCACCGGCGTCCCTGATCGCCAACAACGCCGGAGTGGAAGGGGAGGTCGTGATCGAGAAGATCAAGGAGA
GCGAGTGGGAGATGGGTTACAACGCGATGACCGACAAGTACGAGAACCTGATCGAGTCGGGCGTCATCGACCCCGCCAAGGTGACGAGATGCGCGCTCCA
GAACGCCGCCTCGGTGTCCGGAATGGTCCTCACCACGCAGGCGATCGTCGTCGAGAAGCCCAAGCCCAAGCCCAAGGTCGCCGAGCCAGCGGAGGGGCAG
CTCTCCGTCTGATCGAGCTGTCTATATGTAAAGCTCTCTTCAGGCCTCCCCCGTTTTTTTAGATTTTGCTTCAGTTCAGGCCAAGCCAAGCAGTAGAATT
TTGGTTGAGATCAACTGGAAGTGAAAAAGGTCTAGAGTAAGAGTAGGATTGCCATTTTTGCGAATCGAACGATAACCTTCCTCGCCTGATCTGAATGAAC
TCTTGTGAATCAGAGAAAATCTTCAGCATCATT
page-top