Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1439
Contig Information
Length 822 bp
Tissue Shoot with heat shock treatment
Clones 22 Clones [Download: CSV  ,  FASTA ]
whvh10d17    whvh10o09    whvh11b20    whvh11p19    whvh12m04    whvh4h12    whvh13a07    whvh13e13    whvh14m11    whvh14o05    whvh17o24    rwhvh10o09    rwhvh11b20    rwhvh11p19    rwhvh12m04    rwhvh1h16    rwhvh4h12    rwhvh13a07    rwhvh13e13    rwhvh14m11    rwhvh14o05    rwhvh17o24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 17.4 kDa class I heat shock protein 3 [Zea mays]
Score 537
Evalue 5.58673e-53
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1439
CCGATCAAAAGAGCTACCACAAATCAATCGCTCACCCTTCCGCTTCCAACACTAATCAAATCGTCGATTCCTTCCACCAGCAGCTCGAATCCCCATCAAC
AATGTCGCTGATCCGCCGCAGCAACGTGTTCGACCCCTTCTCCCTCGACTTCTTCGACCCTTTTGACGGCTTCCCCTTCGGCTCCGGCAGCAGCAACAGC
GGCGGCAGCCTCGTCCCGCGCACCTCCTCCGACACGGCGGCCTTCGCGGGCGCGCGCATCGACTGGAAGGAGACGCCCGAGGCGCACGTGTTCAAGGCGG
ACGTCCCCGGGCTGAAGAAGGAGGAGGTGAAGGTGGAGGTGGAGGACGGCAACATCCTCCAGATCAGCGGCGAGCGGAACAAGGAGCAGGAGGAGAAGAC
CGACACCTGGCACAGGGTGGAGCGCAGCAGCGGCAAGTTCCTCCGCAGGTTCCGGCTCCCGGAGAACGCCAAGGCGGAGCAGGTGAAGGCGTCGATGGAG
AACGGCGTGCTCACCGTCACCGTGCCCAAGGAGGAGGCCAAGAAGCCCGACGTCAAGTCCATCCAGATCTCCGGCTAGGCGTCTGCGTGCTCGCTGCGCG
ATGAGGTGGACTGCAGAGCAGAGGTGTGGAGTTTCGCCCCGGTGGTAGTGATGAAATTAAAAAAAACCAGAGTCCGGCTGTCCGTGCGTGCGCTGTGTGT
CTAGTACTCTAGCGTTGTGTGCGAATAAATCTCGTCTGTGTTTCGAGTCCAGTTTGCTCATCCATCTGTATTTCATCANCAACTGAGTAAATCCATTANT
ATATTCTCTGCTAAAAAAAAAA
page-top