Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1432
Contig Information
Length 775 bp
Tissue Shoot with heat shock treatment
Clones 20 Clones [Download: CSV  ,  FASTA ]
whvh10c17    whvh1l10    whvh2b10    whvh4b06    whvh9a12    whvh14c12    whvh14j22    whvh15g07    whvh16n17    whvh19h10    rwhvh10c17    rwhvh1l10    rwhvh2b10    rwhvh6e07    rwhvh9a12    rwhvh14c12    rwhvh14j22    rwhvh15g07    rwhvh16n17    rwhvh19h10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Thioredoxin M-type, chloroplastic; Short=Trx-M; Flags: Precursor >gi|4138592|emb|CAA06735.1| thioredoxin M [Triticum aestivum] >gi|56709480|emb|CAI35908.1| thioredoxin M precursor [Triticum turgidum subsp. durum]
Score 935
Evalue 3.57037e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1432
CGCTTTTTTCTCTTTGTTTCTCCCACTGTCTCCGTGACCAGCAATGGCCTTGGAGACATGCCTCAGGGGCTGGGCCCTGTACGCGCCCCAGGCTGGCATC
AGGGAACGGCTTAGCAGTGGCAGCTACGCGCCATCCCGGCCAAGGACCGCCGCCCCCGCCGTCGTCTCGCCGTCCCCATACAAGTCCGCTCTGGTTGCGG
CACGGCGGCCGTCTCGCTTCGTCTGCAAGTGCAAGAACGTCGTCGACGAAGTGATTGTGGCTGACGAGAAGAATTGGGATAACATGGTGATCGCGTGCGA
GTCGCCGGTGCTGGTGGAGTTCTGGGCGCCGTGGTGCGGGCCGTGCCGGATGATTGCCCCGGTGATCGACGAACTGGCAAAGGACTACGTGGGGAAGATC
AAGTGCTGCAAGGTGAACACGGACGACTGCCCAAACATCGCATCCACCTACGGCATCCGGAGCATCCCCACCGTGCTCATGTTCAAGGACGGCGAGAAGA
AGGAGAGCGTCATCGGCGCCGTCCCGAAGACAACCCTCTGCACCATAATCGACAAGTACATCGGCAGCTAATTAATCATTCTTAATTAGCGATTAATCGA
GGACGCACACACCTTTACTGTTCTGTTCGCGAGACAGCATATATGTATGTATATGATGCGCGTATACGATCCACCGACCAGTTGTGACTTGTACTATTCT
TAATTCTGATGCAAATCAAAACTGATTTATTCGGGCACGTCAGTATACATGCATGTTCGTAAATCAAAAAAAAAA
page-top