Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1428
Contig Information
Length 807 bp
Tissue Shoot with heat shock treatment
Clones 18 Clones [Download: CSV  ,  FASTA ]
whvh10f11    whvh10m09    whvh2e03    whvh4a12    whvh8g13    whvh8g14    whvh15b01    whvh17e07    whvh18n12    rwhvh10f11    rwhvh10m09    rwhvh10m10    rwhvh4a12    rwhvh8g13    rwhvh17e07    rwhvh17e18    rwhvh17g13    rwhvh18n12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycine decarboxylase subunit [Triticum aestivum]
Score 783
Evalue 1.60706e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1428
CACATTCACTTTGTTGCTTCAGGTTGCAACAGCTAAATTAGGCTACAATGGCTCTGAGGCTGTGGGCAAGCTCAGCTGCCAATGCCCTCAAGATTTCAAG
CAGCGGCGCCAGGGCCGCTGCCCCGGCCTACTCGATCTCCAGATACTTCTCCACCGTTATTGATGGCTTGAAGTACACTTCCTCCCACGAGTGGGTCAAG
AACGACGGCTCCGTGGCCACGATTGGCATCAGTGACCACGCCCAGGGCCATCTCGGGGAGGTGGTGTTCGTGGAGCTGCCGGAGACCGGCACGAAGGTGA
GCCAGGGTGGGGCCTTCGGCAACGTGGAGAGTGTGAAGGCCACCAGCGACGTCAACTCGCCCATCTCCGGCGAGGTCGTCGAGGTCAATTCGAAGCTGTC
CGAGACCCCGGGCCTGATCAACTCGAGCCCGTACGAGGAGGGGTGGATGATCAAGGTGAAGCCGAGCAGCCCGGCGGAGCTGGAGGGCCTGCTGGACTCG
GCCAAGTACACCAAGCACTGCGAGGAGGAGGACGCCCACTAGTGCTCCCTTGTTCGCTTATCAATCCTTTTGCTGCAACCATATCGAATACTCTTGTCTA
CAATAATTAAACCAGCTTCACCATGCGTTCAGTTCATCGGTTCCAATTTTCTTGTGTCGGTGTACATGGCGGCCAGCACTTTGTTATACCATTTCAGTGA
CCGTGACATCAGAGATATGGGAAAGAGTTTGTAAGTTATAGTGTGTTGGTAAAAAGAGACATTATCATCCACCAACAAATCATCATATATAACTACTCTA
ATATGGT
page-top