Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1419
Contig Information
Length 1022 bp
Tissue Shoot with heat shock treatment
Clones 16 Clones [Download: CSV  ,  FASTA ]
whvh10f20    whvh5k14    whvh5l01    whvh6g08    whvh15j11    whvh16d22    whvh17o22    whvh19p04    rwhvh10f20    rwhvh5k14    rwhvh5l01    rwhvh6g08    rwhvh15j11    rwhvh16d22    rwhvh17o22    rwhvh19p04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 16.9a kDa heat-shock protein [Triticum monococcum]
Score 610
Evalue 2.77855e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1419
GTCAAGCAAAAGCCAGCAGTATCATATTCCTACCAACGATCCGATACAGAATTTTCTGAGCTCACAACCCGAAGCAATCAACACCAGCAATGTCGATCGT
GCGGCGGAGCAACGTCTTCGACCCCTTCGCCGACCTCTGGGCGGACCCCTTCGACACCTTCCGCTCCATCGTCCCGGCGATCTCAGGTGGCAGCAGCGAG
ACGGCCGCGTTCGCCAATGCTCGCATGGACTGGAAGGAGACCCCCGAGGCGCACGTCTTCAAGGCCGACCTTCCAGGCGTGAAGAAGGAGGAGGTCAAGG
TGGAGGTGGAGGACGGCAACGTGCTCGTCGTCAGCGGCGAGCGCACCAAGGAAAAGGAGGACAAGAACGACAAGTGGCACCGCGTGGAGCGCAGCAGCGG
CAAGTTCGTCAGGCGGTTCCGGCTGCCGGAGGACGCCAAGGTGGAGGAGGTGAAGGCCGGGCTGGAGAACGGTGTGCTCACCGTCACCGTGCCCAAGGCC
GAGGTCAAGAAGCCCGAGGTGAAGGCCATCCAGATCTCCGGCTGAGTGAATGCGTCTCTGCGAATGATCATCAGGGTTGGAGCCAGTTTGGTTAATGTGT
GCGAGTTCTGCAACCTGAAAGTATGCTATAGTTGTGTCTTCGTCTTGCCGAGTCTGATGAGACATCTCTGTAGTGCGTTTCTTTCCCCAGCCGTGTATGT
TCTTGTGTAATCGCCAACAGATTTGGCGATGAATAAATGAAAAATAAACCCTTCTGTTTTTAAGTGCAATGCAGATTTTGCATACACAAAATTTGACCCT
TTTTTTCTTTGCTTGTAGTTCGGATGGAAAGGATCAGGAGAAAAATGATCTTTTTTTTCTCGTTTTCTGAGGTTGCTCGAAATATTCGTTGAGTGGCTAA
AAATGGCTGCCTCGCAAATGGGAACTGTTAGAGTTATAATATAGGTCATGTACCCCTTTGTATTTATCCCGTTGTATAATGGGTTTTCTGCATATGTTCC
ACACCTGTACATGTATATATAT
page-top