Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1416
Contig Information
Length 723 bp
Tissue Shoot with heat shock treatment
Clones 15 Clones [Download: CSV  ,  FASTA ]
whvh10f07    whvh10p08    whvh11n19    whvh6a21    whvh8p21    whvh8p22    whvh9e15    whvh16h22    rwhvh10f07    rwhvh10p08    rwhvh11n19    rwhvh6a21    rwhvh8p21    rwhvh9e15    rwhvh16h22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative membrane protein [Triticum aestivum]
Score 757
Evalue 1.35547e-78
Total Hit Count 56
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1416
CACACGGAGACGTACGACCATTCGCATCGCAGCACACCAGCTTAGACATGGCCGCCGCCACCTCCACCGTCTCCGGCCTCGCCGGCGCCGCGCTCACCCG
CCGGCCAGCCTTCTCTACCAGCTTCACGAGTGGTGCCCGGGTGTCGGCGAGGAACCCGCTGATGACGAGGAACCTGGAGAGGAACGGCAGGATCACCTGC
ATGACGTTCCCGCGGGACTGGCTGCGGAGGGACCTGAACGTGATCGGGTTCGGGCTGATTGGGTGGCTGGCACCGTCGAGCATCCCGCTGATCAACGGCA
ACAGCTTGACGGGGCTCTTCTTCTCCAGCATCGGCGAGGAGCTCGCCCACTTCCCGTCGCCCCCGGCTCTCCAGTCGCAGTTCTGGCTGTGGTTGGTGAC
GTGGCACCTGGGTCTGTTCATCGCGCTCACCTTCGGCCAGATCGGGTTCAAGGGCAGGACCGAGGACTACTTCCAGAAGTAGCGAATTAACTAGCTTTGG
TTCGTGCATGTGCGTCGTCCTTGGGCTGCTCAAGGGCTGCTTCTGCGCATGCGTGTTCAATGTAAAATCTGCCATGCCTTTTGGTTTTGTGCATGCGTGT
GGCTTCGCAAGCCGTGTGATTGCTGTTTGTTAATTACCTCTTCCATGGTAAGCACAAAAGAGTTCAACAACGACAACTACTACTACAACAACAACAATTT
GTCACCGTGGCCTAAAAAAAAAA
page-top