Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1397
Contig Information
Length 1089 bp
Tissue Shoot with heat shock treatment
Clones 12 Clones [Download: CSV  ,  FASTA ]
whvh10d19    whvh5o10    whvh13o23    whvh15o17    whvh16g09    whvh17j10    rwhvh10d19    rwhvh5o10    rwhvh13o23    rwhvh15o17    rwhvh16g09    rwhvh17j10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 16.9a kDa heat-shock protein [Triticum monococcum]
Score 695
Evalue 4.24403e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1397
CCAGCGTCAAGCAAAATCCTACGTACGATCCGATACAGAATTTCCCCCCGAGCTACAAACCGAAGCAACACCGAGAATGTCGATCGTGAGGCGGAGCAAC
GTGTTCGACCCCTTGGCGGACCTCTGGGCGGACCCCTTCGACACCTTCCGCTCCATCGTCCCGGCGATCTCAGGCGGCAACAGCGAGACGGCCGCGTTCG
CCAACGCCCGGATGGATTGGAAGGAGACCCCCGAGGCGCACGTCTTCAAGGCCGACCTCCCCGGCGTGAAGAAGGAGGAGGTCAAGGTGGAGGTGGAGGA
CGGCAACGTGCTGGTCGTCAGCGGCGAGCGCACAAAGGAGAAGGAGGACAAGAACGACAAGTGGCACCGCGTGGAGCGCAGCAGCGGCAAGTTCGTCAGG
CGCTTCCGCCTCCCCGAGGACGCCAAGGTGGAGGACGTGAAGGCCGGGCTGGAGAACGGGGTGCTCACCGTCACCGTGCCCAAGGCCCAGGTCAAGAAGC
CCGAGGTGAAGGCCATCCAGATCTCCGGCTGAGTGCATGCGTCTCGACGTATGGTCATCAAGGATGGAGCCAGTTTGGTTGATGCGTGTGCGAGGTCTGC
AACCTGAATGTATGCTACAGTTGTGTCTTTGTTCTTGCCGATCGAGTCTGGCGAGGCATCTCTGTACTGCGTTTCTTTCGCTGGTCGTTTCTGTTCTTGT
GTAATCGCCAACAGATTTGATGATGAATAAATGAGAAATAAGCCGTTCCGATTTTGGGTGCAGTGCAGATTTTGCATACACAAATTTGACCTTTCTTTGC
TTGTACTAGTTCGGATGGACAGTTTTCTCAAGTAGCTGAAAAGATTCATTGTACACAAGGAAAGATTCACTGAAAATGGCAGCCTGGCAAGCAGGTACTA
GGTCTGCTTAAAGAATAATCGATACACGAATCCGTCTCACATTCAGCTTTCATTAATCGTGGGTCTACACTGATCAATACCCTGAATGCCCTGATTGTTG
ATTGTGTGACTTCTATCTCACCTTCAGTTTTCTTCTTTCTTGAGACATACTTTCAGTTTTCTTTTATCTTTTTTCTTTGAAAAAAAAAA
page-top