Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1386
Contig Information
Length 1508 bp
Tissue Shoot with heat shock treatment
Clones 10 Clones [Download: CSV  ,  FASTA ]
whvh10c18    whvh10e19    whvh6c18    whvh6d17    whvh8c10    whvh14o09    whvh14o23    whvh17l01    rwhvh10e19    rwhvh6f07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0171300 [Oryza sativa (japonica cultivar-group)] >gi|78099750|sp|Q40677|ALFC_ORYSJ RecName: Full=Fructose-bisphosphate aldolase, chloroplastic; Short=ALDP; Flags: Precursor >gi|62732953|gb|AAX95072.1| Fructose-bisphosphate aldolase class-I [Oryza sativa (japonica cultivar-group)] >gi|108864046|gb|ABA91630.2| Fructose-bisphosphate aldolase, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644566|dbj|BAF27707.1| Os11g0171300 [Oryza sativa (japonica cultivar-group)] >gi|125533557|gb|EAY80105.1| hypothetical protein OsI_35277 [Oryza sativa Indica Group] >gi|125576361|gb|EAZ17583.1| hypothetical protein OsJ_031792 [Oryza sativa (japonica cultivar-group)] >gi|215740860|dbj|BAG97016.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1864
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1386
GGCTGCAATTGTAAGGTGTGTCAAAGAAGAGGGTAGCACCTGATCTGCTTGCCTCCAGAAACAATGGCGTCTGCTACTCTCCTCAAGTCGTCTTTCCTTC
CCAAGAAGGCCGAATGGGGCGCCACGCGCCAGGCTGCCGCCCCCAAGCCGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCGTACGCCGATGAGCTTGT
CAAAACCGCGAAAACCATCGCATCGCCAGGCAGGGGTATCCTTGCCATGGATGAGTCGAATGCCACCTGTGGCAAGAGACTCGCCTCGATTGGCCTTGAG
AACACTGAGGCTAACCGCCAGGCTTACCGGACCCTCCTTGTCACTCCACCAGGATTGGGAAACTACATCTCTGGTGCTATCCTCTTTGAGGAGACCCTCT
ACCAGTCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGTATCAAGGTTGACAAGGGTCTTGTGCCACTTGTTGG
TTCCAACGATGAGTCATGGTGCCAAGGTCTCGATGGCCTTGCCTCCCGTGAAGCAGCATACTACCAGCAAGGCGCCCGCTTCGCCAAGTGGCGCACTGTT
GTCAGCATTCCTAATGGCCCATCTGAGCTTGCTGTCAAGGAAGCTGCCTGGGGTCTTGCCCGTTACGCGGCCATCTCACAGGACAATGGGCTGGTGCCGA
TTGTGGAGCCTGAGATCATGCTCGACGGTGAGCACGGCATCGAGAGGACCTTCGAGGTCGCGCAGAAGGTGTGGGCGGAGACCTTCTACTACATGGCCCA
GAACAACGTCATGTTTGAGGGCATCCTCCTGAAGCCAAGCATGGTGACCCCTGGTGCCGAGTGCAAGGACAGGGCCACCCCTGAGGAAGTAGCCAGCTAC
ACCCTCAAGCTCCTCCAGAGAAGGATCCCCCCTTCCGTCCCCGGCATCATGTTCTTGTCTGGCGGTCAGTCGGAGGTTGAGGCAACGCTGAACCTCAACG
CGATGAACCAGGCGCCGAACCCGTGGCACGTGTCCTTCTCCTACGCGCGGGCGCTGCAGAACACCTGCCTCAAGACGTGGGGCGGGCGGCCGGAGAACGT
GGCCGCGGCGCAGGAGGCGCTGCTGCTGCGCGCCAAGGCCAACTCCCTGGCGCAGCTCGGCAAGTACACCAGCGACGGCGAGGCCGCGGAAGCCAGCGAG
AACATGTTCGTCAAGAACTACAGCTACTGATCCGTCGGCGAGCTGTCTATCTAATAATCTACCGCATCACTGTCAGCCAGTAGCGCCTTGAGCAGCTTGA
GGGCGCCTTAGCCAGCCAGTGGGTCGTCGTTGTTACAGGTCGAGACCAGCTCTGATGGAAGAGATGGACAGAGAGTATATACTGTGTTTTGCCACCCTAA
GTAAACTACTTTGGAATGGTCCTATCTGTTGTATTCGCATGGTTTTTTCTAGAGCATTGTTGCCTTTGTTTGCTACCGTAAGTATGAACAATCTGAAGCG
CCCCCCCT
page-top