Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1385
Contig Information
Length 1044 bp
Tissue Shoot with heat shock treatment
Clones 10 Clones [Download: CSV  ,  FASTA ]
whvh10c07    whvh5f10    whvh15e19    whvh15e20    whvh19f15    rwhvh10c07    rwhvh5f10    rwhvh15e19    rwhvh15e20    rwhvh19f15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit triosephosphat-isomerase [Triticum aestivum]
Score 1255
Evalue 4.59454e-136
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1385
CGCGCCACCAAATCCAATCTCGAGCCCCCCTCTCCCGTCCGCCCGTCCCAACCCGATCCGATCTCCCCCCTCCTCCTCCGTCGCCATGGGCCGCAAGTTC
TTCGTCGGCGGCAACTGGAAATGCAATGGAACTGTCGAACAGGTAGAGAGCATCGTCAATACTCTGAACGCTGGACAGATCGCCTCTACGGATGTTGTCG
AGGTTGTCGTTAGCCCGCCCTATGTCTTCCTTCCCACCGTCAAGGGTAAGCTGCGCCCAGAGATCCAAGTTGCTGCTCAGAACTGCTGGGTGAAGAAGGG
CGGTGCTTTCACCGGTGAAGTCAGTGCTGAGATGCTTGTCAACCTCGGCGTTCCCTGGGTCATCCTTGGACACTCTGAAAGGAGGAGCTTGATGGGAGAA
TCAAGCGAGTTTGTTGGAGAGAAGGTTGCATATGCACTCGCTCAGGGCTTGAAGGTCATTGCATGTGTTGGTGAGACTCTTGAGCAGCGAGAAGCTGGAT
CAACCATGGCGGTTGTCGCTGAACAGACAAAAGCAATTGCTGACAAGATCAAGGACTGGACCAACGTGGTCGTCGCCTATGAACCAGTGTGGGCCATTGG
CACCGGTAAAGTTGCATCACCGGCTCAGGCACAGGAAGTCCATGCCAATCTGAGGGACTGGCTCAAGACCAATGTGAGCCCCGAGGTTGCTGAATCCACG
CGGATCATCTATGGAGGATCTGTAACTGGCGCAAGCTGCAAGGAGTTGGCCGCGCAGCCCGACGTCGATGGTTTCCTCGTTGGTGGAGCTTCCTTGAAGC
CTGAGTTCATCGACATCATCAACGCCGCCACCGTGAAGTCTGCCTAAGCAAGATCTCGACGTGGCTCCTTTCGGCGTGGAGTAAGACAGCGAAGATGAAG
AGACTCCTTTTTTTCTCTCCTGTGTTTATTATGTGTACTATGCTAGTAATTTTGTGGTGGAGCAGCTGCTACTGTGTTTCCTCCCCCTGACTTGAGCTTG
CAAGCCAATAATGATAATGTTTGCTACTGAACATATATCAGCAA
page-top