Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1378
Contig Information
Length 1545 bp
Tissue Shoot with heat shock treatment
Clones 10 Clones [Download: CSV  ,  FASTA ]
whvh10b05    whvh6m19    whvh8d21    whvh18d16    whvh19a02    rwhvh10b05    rwhvh6m19    rwhvh8d21    rwhvh18d16    rwhvh19a02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative AdoMet synthase 3 [Hordeum vulgare subsp. vulgare]
Score 1967
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1378
TTTTTTTTTTATGAGGAACTACACAACAAAGAATATGAAAAGTGAAAGTGACAGAGCGACTAACAGAGCAAACTGCACATCACTCAGCAGTTTCAGCGAC
TCAAAATGGAAAGGATAAATATATGAAATGACATTAAGAAACTTAGCACTGACTACCATACAACAAGACCAGTGTAGAGCGTCGCTTCAATGTCTAATGC
TTCTTCCCACTTCCCAGGAGCAACATGATCCCGTCTTGACGAACTTGAGAGGCGGCAGACCAAGAGAATGCCATGCTCTTAGGCAGATGCCTTGTCGAAC
TTGAGGGGCTTCACCACCTCCCAGGTGAAGTCGGCATCATCACGGCCAAAGTGACCGTAAGCAGCGGTCTTGATGAACCTGTTTCCACCTTTCTTCAAGT
CCAGGTTGATGCTGATCATCCCGGGCCTGAAGTCAAAGTTCTCCTTCACGAGCTTGAGGATCTCCCTGTCGGGGATCTTGCCGGTGCCGTAGGAGTCGAC
GAACACAGACAAAGGCTCAGGCACACCGATGGCGTATGAGATCTGCACAATGCAGCGGCGTGCGAGGCCGCTGGCGATGATGCTCTTGGCGGCCTGCCTG
GCAATGTAGGCGCCACTGCGGTCGACCTTGGTTGGGTCCTTGCCAGAGAAGGCACCGCCGCCGTGGGCTCCCCAGCCACCATAGGTGTCGATGATGATCT
TGCGGCCGGTGAGACCGGCGTCACCGTGAGGGCCGCCGATGACGAAGCGGCCAGACGGGTTCAGGTGGAAGATGGTGTTCTCATCGAGGTACTTCGCGGG
GATCACCGGCTTGATGACATGCTCCTTGAGGTCCGCGGCAATCTCGTCGTTGGTGACGGTCTCGTCGTGCTGGGTGGAGATGAGGACGGTGTGCACACGA
ACAGGTACCATGGCACCATCCTCGTTTAGGTACTCGACAGTGACCTGGGTCTTTCCGTCAGGCCTAACCCAGGCGCAGGTGCCATTCTTGCGGACCTCGG
TGAGGCGAGCTCCGAGCTTGGTGGCAAGCACGTGGCTGAGGGGCATCAGCTCAGGGGTCTCGTCGGTGGCATAGCCGAACATGATGCCCTGGTCACCGGC
GCCAACCTCTTCAGGACGCTTGGTGAAGTGTCCGTGAACACCCTGGGCAATGTCAGGGGACTGCTGCTCGATGTTGACGAGCACCTTGCAACGGTCGGCG
TCGAGACCAACGTCATCAGAGATGAAACCGATGTTGCGGCAGGTGTCGCGCACGATCTTCTCATAGTCGACGGTGGCCTTGGTGGTGATCTCGCCCAAGA
CCATGACCATGTTGGTCTTGGTGACGGTCTCGCAGGCGACCTTGCTGTCGGCATCCTGGGCCAAGCAGGCATCCAAGACGGCGTCGGAGACCTGGTCACA
GAGCTTGTCGGGATGGCCCTCGTTCACAGACTCGGACGTGAAGAGGAACGTCTCGGCCGCCATTTCTTTAGTGCTAGCGGTGCTCTTGCGCTGCTTCTAC
TGCTCGATCGGGAGGCCGATGAACCGAGGGAGGGAAGAGGCGGAA
page-top