Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1373
Contig Information
Length 820 bp
Tissue Shoot with heat shock treatment
Clones 10 Clones [Download: CSV  ,  FASTA ]
whvh2g02    rwhvh10c18    rwhvh2g02    rwhvh6c18    rwhvh6d17    rwhvh6g07    rwhvh8c10    rwhvh14o09    rwhvh14o23    rwhvh17l01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit fructose 1,6-bisphosphate aldolase precursor [Avena sativa]
Score 940
Evalue 1.03905e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1373
CATTCGAATACAGCAGTAAAACCATTCCAAAAGTTTTTTACTTAGGGTGGCAAAACACAGTATATACTCTCCGTCCATCTCTTCCATCAGAGCTGGTCTC
GACCTGTAACAACGACGACACACTGGCTGGCTAAGGTGCCCTCAAGCTGCTCAAGGCGCTACTAGCACTCTCCCTCCATAGGTAGATAATTAGATAGATA
GCTCGCCGACGGATCAGTAGCTGTAGTTCTTGACGAACATGTTCTCGCTGGCTTCCGCGGCCTCGCCGTCGCTGGTGTACTTGCCGAGCTGCGCCAGGGA
GTTGGCCTTGGCGCGCAGCAGCAGCGCCTCCTGCGCCGCGGCCACGTTCTCCGGCCGCCCACCCCACGTCTTGAGGCAGGTGTTCTGGAGCGCCCGCGCG
TAGGAGAAGGACACGTGCCACGGGTTCGGCGCCTGGTTCATCGCGTTCAGGTTCAGCGTCGCCTCCACCTCCGACTGACCGCCAGACAAGAACATGATGC
CGGGGACGGAAGGGGGGATCCTTCTCTGGAGGAGCTTGAGGGTGTAGCTGGCCACTTCCTCGGGGGTGGCCCTGTCCTTGCACTCGGCACCAGGGGTCAC
CATGCTTGGCTTCAGGAGGATGCCCTCAAACATGACGTTGTTCTGGGCCATGTAGTAGAAGGTCTCCGCCCACACCTTCTGCGCGACCTCGAAGGTCCTC
TCNATGCCGTGCTCACCGTCNAGCATGATCTCANGCTCCACAATCGGCACCANCCCATTGTCCTGTGANATGGCCGCNTAACGGNCAANACCCCANGCAG
CTTCCTTGACANCAAGCTCA
page-top