Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1356
Contig Information
Length 1210 bp
Tissue Shoot with heat shock treatment
Clones 9 Clones [Download: CSV  ,  FASTA ]
whvh10e11    whvh10e12    whvh3e20    whvh17p03    rwhvh10e11    rwhvh10e12    rwhvh10e24    rwhvh3e20    rwhvh17p03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0242400 [Oryza sativa (japonica cultivar-group)] >gi|62733863|gb|AAX95972.1| Rieske [2Fe-2S] domain, putative [Oryza sativa (japonica cultivar-group)] >gi|62733864|gb|AAX95973.1| Rieske [2Fe-2S] domain, putative [Oryza sativa (japonica cultivar-group)] >gi|62733865|gb|AAX95974.1| Rieske [2Fe-2S] domain, putative [Oryza sativa (japonica cultivar-group)] >gi|77549535|gb|ABA92332.1| Rieske domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|77549536|gb|ABA92333.1| Rieske domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|77549537|gb|ABA92334.1| Rieske domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644811|dbj|BAF27952.1| Os11g0242400 [Oryza sativa (japonica cultivar-group)] >gi|125533933|gb|EAY80481.1| hypothetical protein OsI_35659 [Oryza sativa Indica Group] >gi|125576731|gb|EAZ17953.1| hypothetical protein OsJ_032162 [Oryza sativa (japonica cultivar-group)] >gi|215695042|dbj|BAG90233.1| unnamed protein product [Oryza sativa Japonica Group]
Score 865
Evalue 2.56466e-92
Total Hit Count 211
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1356
TTTTTTTTTTGGAGAACAGCAGATTGCTCCACTAAACTTCACGCCGGAAATAATACAGTATTGTTGTACTCCTTACATGATGATAACAAGCAGCAATATC
TTGTTATTCACTCGATCCGGAAAGAAGTGTTTGAGTGAATAAACCACTTCTTTCAGGTTCGAGTGAATAAATCCGAAAATTAAACAAGCAGAAACCTAGA
TCTAAAATCTTCTCATCTTCTTTTGACATAAACCACTCAATGATCTCATCTGAGATACGGCCAACCGCAGGAAAATGGGATTTCTGAAGCCAGAAACTGG
AAGCAATGAGCTCCGTATGCTAACAGGGAGCAATACTGGCACAAAGAGAATGCTTGATAACACTCCACACTAAACAGAAAACATCTTTACGAGCTGAAAG
CTCTTGAAATTGCATAGATGAAGTCCAATAGACCAGTCCCCTTGAGAAGGCCTTTACCAGTTAAAAGTTCAAAATCTATCAACAATAGAAAGCCAATTAT
GGCAGCTTTTCCGTTGACCAGTTCATTGTAAGCAGTGAAACCAAAACCCCCTACACCTTCATCAACCACCATTCTCACCTCTTCGATGTTGACATCAGAT
GCAGTACTCCCTGGTTGAGCTTTCCCGCTGAACAGAATCTCAGCTGATCCACCAGAGCTAGCAGCGCCCCTAATGCTGATGTATATATTTTCTCCATCCG
TTTTTGCAGGGTACACGAATAGTTTTCTCAATACAGGTGTCAGAGCCCTTAAAACAGGGTTTTTCGGATACCACTCTTTTATTTCCCCAGTGCGAAGATC
AAAGGTACTATCTGTTGATGGGCAAACAATGCAGCCATCCTGCGTGAGCTTGGCGTTGAGGAGGCCCTCGGTGTACGCGCCCTCGGCTGGGGAGCGGTTC
TCAATGGCGAAGACCTCATCCTTGTACCAGAGAAGCAGGATCTCCTCCCCGTCCTGTACGATCACACGGCGCTCTCCCCGCGGGAGCGCCGCCAGCGGCA
CCACCGGTAACCAGCTGCTGCCCCCCTCCGGTCTCTGGAGGCGCCGATGGCTCGGCCCCGGACACATCGGTGGCGCGGCAGGCGAACCTGGGGTGGCACC
GGTTGCGCGCGTGGAAGGGAACCAGGTGGCTACGCGGGGTGGTGGTTGTTGCTGGTGACGAGGAGATACGGCGGTGGAGGAAGGAGGAGGACGCGGTTGT
GGTGGTAATG
page-top