Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1354
Contig Information
Length 1073 bp
Tissue Shoot with heat shock treatment
Clones 8 Clones [Download: CSV  ,  FASTA ]
whvh10a18    whvh10o24    whvh11l04    whvh1b17    whvh8h16    whvh15f09    whvh15f17    whvh15j18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HSP70 [Triticum aestivum]
Score 1640
Evalue 1.09408e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1354
AGAGAGGCAAAGCAAATCGCACCAGGCGAAACACAGAGAGCGCCGCCGTTACCGTCTTCCGGCGAACCCCCAAAGCGAGCGAGCGATTCCAAGGAGAGGA
GAGGAGGCGGAGATGGCCAAGGGCGAGGGGCCGGCGATCGGCATCGACCTCGGGACGACCTACTCCTGCGTCGGCGTGTGGCAGCATGACCGCGTCGAGA
TCATCGCCAACGACCAGGGCAACCGCACCACGCCCTCCTACGTCGCCTTCACCGACACCGAGCGCCTCATCGGCGACGCCGCCAAGAACCAGGTCGCCAT
GAACCCCACCAACACCGTCTTCGATGCGAAGCGGCTGATTGGCAGGAGGTTCTCTGATCCCTCCGTGCAGAGTGACATGAAGCTGTGGCCCTTCAAGGTC
ATCCCTGGCCCGGCAGACAAGCCCATGATCGTCGTCAACTACAAGGGCGAGGAGAAACAGTTCGCAGCGGAGGAGATCTCCTCCATGGTGCTCATCAAGA
TGAGGGAGATTGCTGAGGCCTTCCTCGGCAACTCTGTCAAGAACGCCGTGGTCACCGTCCCGGCCTACTTCAACGACTCCCAGCGCCAGGCCACCAAGGA
CGCCGGTGCTATCGCCGGGCTGAACGTGCTGCGCATCATCAACGAGCCCACTGCTGCTGCCATCGCCTATGGCCTTGACAAGAAGGCGACCAGCACTGGC
GAGAAGAACGTCCTCATCTTTGACCTTGGTGGTGGCACCTTCGATGTGTCTCTGCTGACCATCGAGGAGGGCATCTTCGAGGTGAAGGCCACCGCCGGTG
ACACTCACCTGGGTGGAGAGGACTTCGACAACCGCATGGTGAACCACTTCGTCCAGGAGTTCAAGCGCAAGCACAAGAAGGACATCACCGGCAACCCCCG
CGCTCTGCGTCGTCTCCGGACGGCGTGCGAACGTGCCAAGCGCACGCTGTCGTCGACGGCCCAGACCACCATCGAGATCGACTCGCTGTACGAGGGTGTG
GACTTCTACACCACCATCACCCGGGCTCGCTTTGAGGAGCTCAACATGGACCTCTTCCGCAAGTGCATGGAGC
page-top