Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1369
Contig Information
Length 902 bp
Tissue Shoot with heat shock treatment
Clones 9 Clones [Download: CSV  ,  FASTA ]
whvh10g03    whvh10g04    whvh10n01    whvh11g21    whvh19b15    rwhvh10g03    rwhvh10g04    rwhvh10n01    rwhvh11g21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 1322
Evalue 6.21047e-144
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1369
ATACAGCAGACATTTTTCTTAGCTCTCCAATGGCGGCGACCACCACGTCCCTCTCCTCCTCGACCTTTGCTGGCAAGGCGGTGAAGAATGTACCATCGCC
AGCTCTCTTCGGCGAGGCCCGTGTGACCATGCGCAAGACTGCAGCGAAGGCTAAGCAGGTTTCCTCTGGCAGCCCATGGTATGGTGCTGACCGGGTGCTC
TACCTCGGCCCACTCTCTGGTGAGCCCCCGAGCTACCTGACCGGTGAGTTTCCTGGTGACTATGGGTGGGACACTGCTGGGCTTTCAGCTGACCCCGAGA
CTTTCGCCAAGAACCGGGAGCTCGAAGTGATCCACTGTCGCTGGGCCATGCTCGGAGCACTTGGTTGTGTCTTTCCGGAGTTGCTGGCCCGCAATGGCGT
GAAGTTCGGTGAGGCCGTTTGGTTTAAGGCCGGCTCCCAAATCTTTAGTGAGGGTGGTCTTGACTATCTTGGCAACCCCAGCCTCGTCCACGCGCAAAGC
ATCCTAGCTATTTGGGCATGCCAGGTCGTGCTCATGGGTGCTGTTGAGGGGTACCGCATTGCCGGTGGCCCGCTTGGTGAGATCGTCGACCCACTCTACC
CAGGCGGCAGCTTCGACCCTCTTGGCCTAGCTGACGACCCTGAGGCATTTTCCGAGCTCAAGGTGAAGGAGATCAAGAATGGTCGTCTTGCCATGTTCTC
AATGTTTGGCTTCTTTGTCCAAGCTATCGTCACGGGCAAGGGCCCTCTTGAGAACCTTGCTGACCACATCGCCGACCCTGTCAACAACAATGCATGGGCA
TTCGCCACCAACTTTGTCCCCGGCAAGTAAGGTGTCTTGGGACTGTGCTCGCCATAAGGCATGTTGTCCTATGGTCTGAGTTGTACTATCATGATGTAAC
AT
page-top