Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1337
Contig Information
Length 720 bp
Tissue Shoot with heat shock treatment
Clones 8 Clones [Download: CSV  ,  FASTA ]
whvh10e22    whvh2k19    whvh4p13    whvh13o05    rwhvh10e22    rwhvh2j17    rwhvh4p13    rwhvh13o05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosome-like protein [Zea mays]
Score 459
Evalue 4.82128e-44
Total Hit Count 368
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1337
ACTCAAAGAGAGCGCAGCAACCGTCAGAGCCGACTAGTCGAAGGCCACAGCCATGGCCGCCCCTACCGGCACTTCCATGCTAAGGGCCCTGCTCCAGCTT
CCCCTGGCTCCGTTCTCGGGGAAGAGCTCCGCGCCTTCGGCGGTCCACATGACCGCCCGCCGCGCGCCGACGCCCGTGCTGGCCGCCAAGGGCTACAACG
TGCAGATCGTGGTGGACGAGAACGAGGGGGAGGACTCCATCTTCCGGCGCTTCCGGCGGGAGGTGATGAAGGCCGGCCTGCTCCAGGAGATCAAGCGCCG
CCGGCGGCACGAGAACACCAAGGACAAGAAGATCCGCAAGGCCCGCGAGGCCGGCCGCCGCAACCGCCGCAGGCGTATGATGGATGATCGTAGGTTCCCC
GAAGATGAGGGAGACTCAGAGGCTGTGAGAACCCGCCGCGACGAGGACAACGACAACTGGGAGGTTAGCGGTATTCTGTGAATGGAATGATGACGGAATT
CATAACAACTTTAGATGCACAGCTCTGGCAATTCGAGATCTTCTTTTGCCTGCATGGCACAAACTATATGAGTCACCAGCCGCCCTTTCCAGTTCAATTG
TACTATTTAATTGTACCAAATGTTAGCTAATGCAATCTCCATTCCGTATACTTCTGTACTACTACTTTTTTTTTTACTTCAAGATTCGGCACATGTTGCG
AATGCAAAGCAAAAAAAAAA
page-top