Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1301
Contig Information
Length 1259 bp
Tissue Shoot with heat shock treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whvh10e14    whvh9m21    rwhvh10e14    rwhvh12g20    rwhvh12k16    rwhvh3c17    rwhvh9m21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Catalase-1 >gi|1408512|dbj|BAA13068.1| catalase [Triticum aestivum]
Score 1752
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1301
CTTACTCTTCACTTATTCTTAATTCGGTTCATTAATCAAGATGCATTCACTTTACAATAATCATGAAGTATGAGGAGAAACAGGCTCTTGTACAAATTAT
TACATGAATGACGGGCGAGAATGCGCATAACGTGTGCTGGAATCATATGTATGTCCTCTTTTCAAAATAGGCTCAGTAAAATGAAGTAACTAGATGCAGC
ATTTGGTATGTAATTCCTCGCCGATAAGAGGGATGAACCTCGACGGCCGAAGCAGATTTCTGATTTGCGCACTCCATGGACTGATCTTACATGCTCGGCT
TCGAGCTGAGACGGCTCGCGAGCTTCTGGCCGAGAGACTTGTCAGCCTGAGACCAGTAGGAGAGCCAGATGGCCTTGATCTCGTGGGTGAGGCGGGGGTC
GGACAGCGCATCGATCCATCTGTTGATGAATCGCTCTTGCCTTGCCGGGTCCATGGAGCGGTACCTCTCCCCGGGCTGCTTGAAGTTGTTCTCCTTCTCG
ATCACCGTCTTCTCGCGGCGGCCGTTGAGGGTGCGGGAGGGGATGGGGTAGCGGGGCGCGTGCTTGGCGGGGTCGAACCTGGAGGGGAAGTAGTCGACCT
CCTCGTCGCGGTGCATGAAGTTCATGAGCCCGTCGTAGTGGTTGTTGTGGTGGGAGCACTTGGGCGCGTTGGCCGGCAGCAGCAGGTAGTTGGGCCCCAG
CCGGTGGCGCTGCGTGTCCGAGTAGGAGAAGATCCTCGTCTGCAGCAGCTTGTCGTCCGAGTAGTACACCCCGGGGACGATGATCCCGGGGCAGAAGGCC
AGCTGCTCGTTCTCCGCGAAGAAGTTGTCGATGTTGCGGTTGAGCACCAGCCGCCCCACCGGCTGCAGCGGCACCACGTCCTCGGGCCACGTCTTGGTCA
CGTCCAGCGGGTCGAAGTCGAACCGCTCCTCGTGGTCCGGGTCGATGGTCTGGATGTAGAAGGTCCACTCCGGGTAGTTGCCGGCGGCGATGGAGTCGGT
CAGGTCCTTGGTGGCGTGGCTGTGGTTGGTGCCGCCCACGGTGACCGCCTCGTCCTCGAGGAGGGACTTGACGCCGCAGGTGGGCTTCCAGTGGAACTTG
ACGTAGTGCGCCTTGCCGGCGCGGTTGACGAGCGTGTAGGTGTTGACGCCGGAGCCGTCCATGTGGCGGTAGTCGGCGGGCACGCCCACGTCGTCGAAGA
GGAAGGTGAACATGTGGAGCGACTCCGGGTGGTGGGAGAAGAAGTCGAGGATGCGCCAG
page-top