Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1285
Contig Information
Length 1211 bp
Tissue Shoot with heat shock treatment
Clones 7 Clones [Download: CSV  ,  FASTA ]
whvh10g16    whvh5h21    whvh14p12    whvh14p13    rwhvh5h21    rwhvh14p12    rwhvh14p13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Sedoheptulose-1,7-bisphosphatase, chloroplastic; AltName: Full=SED(1,7)P2ase; AltName: Full=Sedoheptulose bisphosphatase; Short=SBPase; Flags: Precursor >gi|14265|emb|CAA46507.1| sedoheptulose-1,7-bisphosphatase [Triticum aestivum]
Score 1745
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1285
CTGCGGGCGAACACGGCGAGGACGTCGTTCCCGGCGGGGAGGCAGTCCAAGGCGGCGAGCCGGGCGGCGCTCACCACCCGGTGCGCGATCGGCGACAGCC
TGGAGGAGTTCCTGACCAAGGCGACGCCGGACAAGAACCTCATCAGGCTGCTGATCTGCATGGGGGAGGCGATGAGGACGATCGCCTTCAAGGTCCGGAC
CGCGTCCTGCGGCGGCACGGCCTGCGTCAACTCCTTCGGCGACGAGCAGCTCGCCGTCGACATGCTCGCCGACAAGCTCCTCTTCGAGGCGTTGGAGTAC
TCCCATGTCTGCAAGTACGCGTGCTCTGAGGAAGTCCCCGAGCTGCAGGACATGGGTGGCCCGGTCGAAGGTGGATTCAGTGTGGCGTTCGACCCCCTTG
ATGGTTCCAGCATTGTGGACACCAACTTCACCGTCGGAACCATCTTCGGTGTCTGGCCTGGCGACAAGCTGACGGGCGTCACCGGCGGTGACCAAGTTGC
CGCTGCCATGGGCATCTACGGCCCTCGCACCACTTTCGTTGTTGCCCTCAAGGACTGCCCTGGAACACACGAATTCCTTCTTCTCGACGAAGGTAAATGG
CAGCATGTCAAGGACACAACAACCATTGGAGAAGGGAAGATGTTCTCCCCTGGTAACTTGAGGGCCACATTTGATAACCCTGATTACGACAAGCTTGTCA
ACTACTATGTGAAGGAGAAGTACACGCTGCGTTACACCGGAGGCATGGTCCCTGATGTCAACCAGATCATCGTGAAGGAGAAGGGCATCTTCACGAACGT
GACGTCCCCGACGGCCAAGGCGAAGCTGCGGCTGCTGTTCGAGGTGGCGCCGCTGGGGTTCTTGATAGAGAAGGCCGGCGGGCACAGCAGCGACGGCAAG
CAGTCGGTGCTGGACAAGGTGATCTCCGTCCTGGACGAGCGGACCCAGGTGGCCTACGGCTCCAAGAACGAGATAATCCGCTTCGAGGAGACCCTCTACG
GCTCCTCCAGACTCGCCGCCAGCGCCACCGTCGGCGCCACCGCCTGATAATCGATCCATCTTCTTTTTTTACGCTTTTTTCAACCTGAAAAACAAGATGT
CCGTTATANAGTTCGTCTGAAGCATGTTGTTGTCTTGTGACGATGCGAACTGGTAATGCAGCGGGCAGACGGGCTTGCTTACGTCTGCCGCCCTTGTCTC
CAAAAAAAAAA
page-top