Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1258
Contig Information
Length 1591 bp
Tissue Shoot with heat shock treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvh10e06    whvh4l20    whvh4m02    rwhvh10e06    rwhvh4l20    rwhvh4m02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0148700 [Oryza sativa (japonica cultivar-group)] >gi|42795390|gb|AAS46022.1| PSAG protein; PSAG1 [Oryza sativa (japonica cultivar-group)] >gi|42795392|gb|AAS46023.1| PSAG protein; OsPSAG [Oryza sativa (japonica cultivar-group)] >gi|52353457|gb|AAU44024.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113578202|dbj|BAF16565.1| Os05g0148700 [Oryza sativa (japonica cultivar-group)] >gi|215697263|dbj|BAG91257.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196093|gb|EEC78520.1| hypothetical protein OsI_18460 [Oryza sativa Indica Group]
Score 1516
Evalue 4.52816e-166
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1258
CAATTCATCTACATTATGGGACTGAGGGAGTATATAATAATTGGGTCGGGGGAAATGAGTTCTCATTACACCACTTCACATTTGTTTAGCACTTATCAGG
TACCTTGACATGCCTTCTCGTGATGTAGTCAACAAGCAGCACATTTTATGCTGCGACGTAACACAGAGAAATGCAGTCGACTCAGTTACACATTTTTCGG
TTCCTATTACACTCTGTACGTGTTGAGTCATTCATCTGATTTACGCCTCACGTGGTGACATCATCTGCTACTCAACTGTCGCTGTCAGTCTCTTCGGAAA
TCAAGTTTTGGTTCATGACAAACCTCAGACTGTCACCCTCTTCAAGCTCCCACTGCTTTCTGAGTTCGCCAATGGCTCTTGCTGCAGAGCTAGCTACAGC
GGGATTGGAATCTTGAGCCAATCTCTGTAATGCGCCCATCCCAGCATTCCCTAGGGTCCACATAGATGGAGCTGCAGCCAATGCATTAGCCAAAGCTTTC
CTGGTATTAACATCTGGAGAACTTGAACATTCAACTATCAAGGAAACACTCTTTTTCCCATCCATAGCATCCAGGTCAATAAGAGCCGCTACTAATAATT
CAAGCTCCTCAGGATTGGTGTAGTCGATACCATCAGCCTCAGATAAGGCAGATGCCATATTAAGATATGCATCCTCTATGGCAGCGATTTGATCAGTAGA
AACTTCACGAGGGAACAACTTAAGAATCTTCCCATTTTTCTCCAGTGTGATGAACTGATATTGTAGTTTGGTTGCCATCATGTCATGAATATCCCGAACA
AACTTTAAAGCCATGAAAGCATCCTCCATGGCACGTCGTCGAACAACCATGTCAGCTCGTCGCAGATCTGCCTCCAAAGCACCATCACTCCAATGTTGAT
CTGCTGCTTTCTTCAAGTCTGAATGAGCTCGCTCCTTCAATATTCTAGCAAAATTGGTTAGGTGGGCTGCCCGTTCCTTCACACTGTTATCAATCTTTCG
GGTGTCCTTCCTTGCACGAGCATCAAGCTTGAGAAACCCCAACCCTAATACAGCAACATCCTTAGATGCACGTTTGTTCAACCTTGTGATGCCACGTGAA
AGCAAAAGAATATCACTCTGAGCTCTTTCATTCACAAACTTTGCATCATTATAGACAAATTGGCACGCTTTAGACAGCCCTTGAGTAGAATATAGTGTTT
TTTCCTGAGCTGCAACTTGACTATCTGAAAAATGTGACATTCCTCTTGGATGCTCATCAAAATCCCTGTAAGGATTGTTGCCATCTTCAGGAATATTGCA
CTCTTTAGTTTCACTGGCACTACGAGAACCATAAGAATGGCACCAAACATTCGGACCTTGTTGGAGTAGGTAACCATTGGACTTCGCATTCGTTTTCCAA
TGCCTATCGTTTGGAAAGGACCTGATGATATGACATCCGTTCATCCACTTCCTTACCTCTACCTCTAGTGGTAAACAATTCGATGCTACGCAGCGTAGTG
CTTTCAGCTTACACGGCATTCTGTGTTTATCATTATAGCACACCCCACTAGATGCTATGGTACCAGATATTTGGCTAGCCATATGTGTCGA
page-top