Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1254
Contig Information
Length 698 bp
Tissue Shoot with heat shock treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvh10d09    whvh1n12    whvh17i02    rwhvh10d09    rwhvh1n12    rwhvh17i02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08812 [Oryza sativa Indica Group]
Score 531
Evalue 2.01922e-52
Total Hit Count 166
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1254
GGACGCACAGGACTAGAAGCGTGTCAGCATAGGCGAGAGCCAGAGAAGAGCTTGCAGGTGAGAACATGGCCGCAACGGCGTGCTCTACGGCGCTTCTGGG
TGTAGCAGGAGCACGCCTCCCCGCCGGCGCGCCGCCAACCGTTCTTCTCCCACGGCGTAACTTCTCCCCTCTTCGCCTCCAAGGCGCGCACGATGCACCG
CGGCTCTCTCTGCTCCGGGCGAAGGCCGCCTCCGATGACACCTCTGCCGCGAGCGGCGACGAGCTCGTCGACGACCTGAAAGCCAAGTGGGACGCCGTCG
AGAACAAGTCCACCGTGCTGACGTACGCCGGCGGCGCCATCGTCGCCGTATGGTTCTCCTCCGTCATCGTCGGCGCCGTCAACTCCCTGCCTCTGCTTCC
CAAAATCATGGAGCTTGTTGGGCTCGGCTACACCGGATGGTTCGTGTACCGCTACCTCCTCTTCAAGGAACGCAGGAAAGAGCTGGCCGACGACGTGGAG
TCTTTGAAGAAGAGCATTGCTGGTACAGAGGCAGAGTAATAAAAGAAAATAATGTTGTATGGATTATTATTTTGTTGGACGATTATTCAGAGAACGCTTA
TCCGAGGGTTTGCTTGTTTTTTTAACAAGACAAAAGACTTGCTATTTCCATTGATTAACAAAGAATGTTTANACAAAATCCGTCTANTAANAAAAAAA
page-top