Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1248
Contig Information
Length 911 bp
Tissue Shoot with heat shock treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvh14m14    whvh18c03    whvh18c04    rwhvh14m14    rwhvh18c03    rwhvh18c04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit meiosis 5 [Zea mays]
Score 540
Evalue 3.0129e-53
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1248
GTTCAGTTGCTTATTCTGTCCTGTCTGCACACACTGAGAGCAATATGGGTGGCAAGGTTCTTCTGATGAGTGCCGTCTTGGTGGGGCTTGTTTCACTGAG
CTCGTGCAGGAGCCTGGGAGAGTTGCATGAGCAGAAGACCCACTATGGGGGCTCACCAACTCCCACGCATGGGTCAGGAGGAGGCTACAACCCGACACTG
ACACCGACACCAACTTACGGCACTACACCGACGCCATCTTACGGCACTACACCGACACCAACTTACGGCATTACACCGACGCCAACTTACGGCACTACAC
CGACGCCATCTTACGGCACTACACCGACGCCATCTTATGGCACTACACCGAGCACCCCAAGTGCACCTTCCCATGATGTCCCTGCAAGTCCAAAGAAGCA
TGGGTTCATTGGATCCTGCGACTACTGGAAGAATCACCCAGATGCTATAGTTGCAGCTATTGGGTCCCTCGGCAACATCGGCAAGACATTTGGTGCTGCA
TGCAGTATGATAGGTGGCAAGAAGCTAGGAAATATGCATGATGCACTCTCAAACACTAGAACTGATGGTATTGGCGCCCTGATACGTGAGGGGGCAGCTG
CATACCTCAACTCCATTGTGAACAAGAAGTTCCCATTTACCACCCAGCAGGTGAAGGACTGTATCGTCGTGGCCGTGACCTCTGATGGTGCTGCTTCTGC
CCAAGCTGGGGTTTTCAAGAAGGCAAATGAATTCCACTACTAGTTTCAGTCATCGGTGTTTCTTGGCTAAATTTCTTCCTCCCGCGCATTTTTCTTGATT
GATGCTATCTTGTGGCTTGATATATTTCTTTTATTTTTGTTGTTTTATCATGTAATATCACTATCTATGGCATTTTGAGTGCAATAAATCCATCCTTTTC
CAAAAAAAAAA
page-top