Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1235
Contig Information
Length 1074 bp
Tissue Shoot with heat shock treatment
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvh10f14    whvh8p10    whvh14p19    rwhvh10f14    rwhvh8p10    rwhvh14p19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0101500 [Oryza sativa (japonica cultivar-group)] >gi|41052893|dbj|BAD07805.1| putative hydroxypyruvate reductase [Oryza sativa Japonica Group] >gi|41053227|dbj|BAD08188.1| putative hydroxypyruvate reductase [Oryza sativa Japonica Group] >gi|113535120|dbj|BAF07503.1| Os02g0101500 [Oryza sativa (japonica cultivar-group)] >gi|215695322|dbj|BAG90513.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1427
Evalue 5.46779e-156
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1235
CTCTTCTCTGCGCTCAGCGTGCCGGCGGGACAGCCTTCAGCAACATGGCCGTCGGTTACAACAACGTTGATGTCGATGCTGCCAACAGGAATGGCATCGC
CATCGGCAACACGCCTGGTGTTCTTACCGAGACGACGGCGGAGCTGGCGGCGTCGCTGTCGGTGGCGGCTGCCCGGAGGATCGTTGAGGCCGACCAATTC
ATGAGGGCTGGCCTCTACGACGGATGGCTTCCGCACTTGTTTGTTGGGAACTTGCTCAAGGGGCAGACTGTTGGAGTGATCGGAGCTGGCCGCATCGGCT
CAGCTTATGCAAGGATGATGATTGAGGGGTTCAAGATGAACTTGATCTACTTCGATCTGTACCAGTCCACACGGCTCGAGAAATTCGTCACAGCGTATGG
CCAGTTCCTGAAAGCCAATGGTGAGCAGCCTGTGACATGGAAGAGGGCCTCCAGCATGGAGGAAGTTCTCAGGGAGGCCGATGTGATAAGCCTGCACCCA
GTGCTGGACAAGACGACGTACCACCTGATAAACCCTGAGCGGCTGGCGATGATGAAGAAGGAGGCAGTGCTGGTGAACGCCAGCCGTGGCCCGGTGATCG
ACGAGGTTGCACTGGTGGAGCACCTGAGGGCGAATCCCATGTTCCGTGTTGGCCTCGATGTTTTTGAGGATGAGCCTTACATGAAGCCAGGGCTGGCTGA
GATGAAGAATGCCGTCGTCGTGCCTCACATCGCATCTGCATCGAAGTGGACGCGTGAAGGGATGGCGACGCTCGCTGCTCTGAACGTGCTTGGTAAGATC
AAGGGGTACCCGGTGTGGGGGAACCCGAACACGGTGGAGCCCTTCCTCGACGAGAAGGCGGCGCCGCCCCCTGCCTGCCCAAGCATCGTTAACGCCAAGC
AACTCGGCCTGCCATCTTCCAAGCTTTAGGCAGAGGCAGAGGCAGAGATGGATGAATCACTGCTACTACTACTACTACTTGCTAAGATGCTATGCATATA
TAGCTCCTTCCCAGTATATATGTATGAATGCCCTCATCCTCATGGAGTAGCAGTACTGAATGAATGAATGAGTA
page-top