Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1145
Contig Information
Length 184 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh8h03    whvh8h04    rwhvh8h03    rwhvh8h04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_16097 [Oryza sativa Indica Group] (no hit)
Score 495
Evalue 2.70131e-48
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1145
TTTTTTTTTTGAGTTCGACTCCCACCCGTGTTGAACAATATAAGTGGGTTAAGACATACACATGATTCATTTACATCTCTCGATTCTCTCTCTAGTTAGG
TATAGTATACTCGCCACACCAGAAGTTGTAGATTACAAACTGAAATAAAAACCATTACCAGTTCCCAGGATTATTACGACAAGC
page-top