Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1061
Contig Information
Length 727 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh10d18    whvh1n23    rwhvh10d18    rwhvh1n23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=16.9 kDa class I heat shock protein; AltName: Full=Low molecular weight heat shock protein; AltName: Full=Heat shock protein 17; AltName: Full=HSP 16.9 >gi|21813|emb|CAA31785.1| unnamed protein product [Triticum aestivum] >gi|445135|prf||1908436A heat shock protein 16.8
Score 674
Evalue 5.81282e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1061
AAAGCAGACAGCATCCTATTCCTACCTACGATCCACAGAATTTTCCGAGCGCACAAGCCGAAGCAATCAACACCGACGATGTCGATCGTGCGGCGGAGCA
ACGTGTTCGACCCCTTCGCCGACCTCTGGGCGGACCCCTTCGACGCCTTCCGCTCCATCGTCCCGGCGATCTCAGGCGGCAGCAGCAGCGAGACGGCCGC
GTTCGCCAGTGCTCGCGTGGACTGGAAGGAGACCCCCGAGGCGCACGTCTTCAAGGCCGACCTCCCCGGCGTGAAGAAGGAGGAGGTCAAGGTGGAGGTG
GAGGACGGCAACGTGCTCGTCGTCAGCGGCGAGCGGAGCAGGGAGAAGGAGGACAAGAACGACAAGTGGCACCGCGTGGAGCGCAGCAGCGGCAAGTTCG
CGAGGCGCTTCCGGCTGCCGGAGGACGCCAAGGTGGAGGAGGTGAAGGCCGGGCTGGAGAACGGCGTGCTCACCGTCACCGTGCCAAAGGCCCACGTCAA
GAAGCCCGAGGTGAAGGCCATCGAGATATCCGGCTGAGCATTGGAGCCAGTTTGATTGACGTGTATGCTACAGTGTGTCTTGTTCTTGCCGATCGAGTCT
GGCGAGACAACTATGTATTGTGTTTCTTTTGCCAGTCGTTTATGTACTTGAGTAATCACCTACAGATTTGGTGATGAATAAGTGAGAAATAAACAAAATT
TGACCTTTTTTGCTTCCAAAAAAAAAA
page-top