Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1054
Contig Information
Length 837 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh16p18    rwhvh3n21    rwhvh16p18    rwhvh17n23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 1012
Evalue 4.81947e-108
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1054
CAGCCTAACATTCCAAAGCAGAGGATAAAAATGAGTAGTCTCAGAAGCTTCCATGTTTTGCCAAAAGCCGAAATTAACACGACAGTACTCAAATGACACA
TCAACAGGGCGCATATCACACGGCGCTAACAGTAGCAAAACTTAATAGGCACTAAACTACTACAGATCTCAAAAGCAGACATAGATGGATTCAGGTAAAC
GCCTCATTTCTTCTTGATGGCAGCCTTGGTCACCTTGGCGCCGGTTGGGTCCTTCTTCTCCACACCCTTGATGACACCAACAGCCACAGTTTGCCTCATG
TCCCGGACAGCAAAACGACCAAGAGGAGGGTAAGTAGCAAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACTATGCCAGCATCACCATTCT
TGAGGAACTTGGGCAGGGCCTCCAGCTCCTTACCAGATCGCCTGTCGATCTTGGTCACCAGCTCAGCAAACTTGACAGCAATGTGCGAGGTGTGGCAGTC
CAGCACTGGGGCATAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCTGCCTCCTTGGCAGGGTCATCCTTGGAG
TTGGATGCAACAAACCCACGCTTCAGATCCTTCACGGCAACATTCTTGACGTTGAAGCCGACGTTGTCACCGGGAAGCGCCTCCAGGAGAGACTCATGGT
GCATCTCAACGGACTTGACCTCAGTTGTCAGACCAGTGGGACCAAAGGTAACAACCATACCAGGCTTGATGACACCAGTCTCAACACGGCCAACAGGCAC
AGTTCCAATGCCACCAATCTTGTAAACATCCTGTAGG
page-top