Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1051
Contig Information
Length 1450 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh10g01    whvh10g02    rwhvh10g01    rwhvh10g02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0429600 [Oryza sativa (japonica cultivar-group)] >gi|77554862|gb|ABA97658.1| retrotransposon protein, putative, Ty1-copia subclass [Oryza sativa (japonica cultivar-group)] >gi|113649181|dbj|BAF29693.1| Os12g0429600 [Oryza sativa (japonica cultivar-group)]
Score 1575
Evalue 5.76542e-173
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1051
AAGCCCATAAGAGTCGGCACGCAGGCCAGGGCGTGCGGTTGCAGATCCTATAATCTAGGGTATACACAGGTGTACATGCCATATATAGAATTAGTCTAAC
ACCCCCCCTCAGCCGGAACGCCATTTGGATGAACGTTCAGGCTGGATCGGAATTCATGGTACACCTGAGATGGCAGCCCCTTAGTGAATAGGTCGGCGAA
CTGAGAACTGGACAGCACATGCAACACGCGGGCTTCACCAAGAGCGACACGATCACGGACGAAATGCAAGTCGATCTCAATGTGCTTTGTGCGCTGATGT
TGAACAGGATTACTGGCAAGATATGAAGCACTGACATTGTCGCAATATACCACAGTGGCACGCCGCGGAGGACACTTGAGCTCATGGAGAAGTTGTCATA
GCCAGCAGGACTTAGCAACACAATTTGCAACTCCGCAGTATTCAGCTTCGGCGCTCGAACGGCTCACAGTTGGTTGTCGTTTGGAGGACCAAGACACCAA
ATTTGAGCCGAGGAAAACACAAAATCCGGATGTGGACTTGCGGGTATCCGGGCAGCCAGCCCAATCTGCGTCGGTGTAAGCCACAAGATCACGAGAAGCA
GATCGGTAGAACTGAAGCCCGTAGTGAGTGGTGCCCCTCAAGTACCGAAGTATGCGCTTGACCAACTGCATGTGGCTATCCCGAGGCGCATGCATGAACA
AGCAGACCTGCTGAACGGCGTAGGAGATGTCAGGCCGAGTGAGGGTAAGGTATTGGAGTGCACCAGCAAGACTCCGGTAATGTGTGGGATTAGAGAAGAG
ATTGCCATCGGTGGAGGAGAGTTTGGAGCTAGTGTCAATGGGTGTGGAAATGGGCTTGCAATTGAGCATCTTAGCGCGGTCAAGAATCTCCAGAGCGTAT
TGTTGTTGGCAAAGAAAGAGACCGGATGTGGTGGGGGTGACATTTATGCCCAAGAAGTGATGAAGGTCACCCAAGTCACTCATGGAGAATTCAGACTTAA
GGGAAGCGATGATGGTGTTGAGTGTGTGTGTAGAGTTGGCGGTAATATTGTCAACATACACAAGGAGATAGGAAATGGATGTACCTCGATGGAGAATGTA
GAGGGAAGAATCACTCCGGGAGGCAGAGAAGCCGAGGGAGAGCAAGTATTGCTTGAACCAGAGAAACCGCTGGCGTGGGGCCTGTTTAAGGCCGTAGAGA
GACTTGCGGAGTAAGCATACATGATCCGGTCGGGCTGGGTCGACGAAGCCAGCGGGCTGAGCACAGACAGTTTCATTGAGCTCACCGTGGAGGAATGCAT
TCTTCACATCAAGTTGGTGGATGGGCCATGAGTGAGATGTGGCAAGACTGAGAACAACACGGATCGTAGAAGGCTTGACCACAGGGCTGAATGTCTCATC
ATAGTCGACACCTTCTTGTTGAGTGAAGCCACGGACCACATATCGCGCCT
page-top