Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1050
Contig Information
Length 1015 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh10g07    whvh7m04    rwhvh10g07    rwhvh7m04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_014974 [Oryza sativa (japonica cultivar-group)]
Score 1194
Evalue 5.23294e-129
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1050
CCGGGTGCCCGCGCGTGGCGCGCGTGGTGATGGCGGCGGCGGTGAAGCACCTGACGCCCGTGGCGCTGGAGCTGGGCGGGAAGTGCCCCTGCATCTTCGA
CGCCGTTGCCGGCAGGAGGAACCTCCAGACCTCGGTGAACCGCGTGATCTTCGCCAAGTGGTCGTCCTGCGCCGGCCAGGCCTGCATCGCCATCGACTAC
GTGCTCGTCGAGGAGCGGTTTGCGCCCACCCTGATCAAGTTGCTCAAGTCGACGCTGAAGAGGTTCATCGCCGACTCGGACCAGATGGCGCGGATCGTCA
ACGGGCGGCATTTCCAGCGTCTGAGTAACCTCCTCAAGGACCCGGCGGTGGCGGCGTCCATCCTGCACGGCGGCGGCTTGGACGCCAAGAACCTGTCCAT
CGAGCCCACGATACTGCTGAACCCGCCGCTGGACTCCGCGATCATGACCGAGGAGATCTTCGGCCCTCTGCTCCCCATCATCACGGTGAAGAAGATCGAG
GACAGCATCGCGTTCGTGAGGGCGCGGCCGAAGCCGCTGGCCGTGTACGCCTTCACCGACAGCGCGCCGCTGAAGCGGCGGATCGTGGAGGAGACGTCGT
CGGGGAGCGTCACCTTCAACGACGCCGTCGTACAGTTCGGGGTGGACACGCTGCCGTTCGGGGGTGTGGGGCAGAGCGGGTTCGGGCAGTACCACGGCAA
GTACTCGTTCGAGATGTTCAGCCACAAGAAGGCGGTGCTGCGGCGGGGCTTCCTGGTGGAGGCCATGCTGAGGTACCCGCCGTGGGACGAGCAGAAGATC
GCCATGATGCGCCACCTCTTCCGCTACGACTACGTCCGCTTCATCTTCACCTTCCTCGGCCTGCGGAGATGAATACGGCCATGCACCACGTCTCGGGCGC
GACTGGATGGGTTTGACGTAAGAAATTGATTATTATTTGATGAGTGGATGAACAAGTACATGAATAAACAGACCACGTTAGTTTGTATAAGGATTGCGTA
GCAGGTTTGCACTCG
page-top