Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1027
Contig Information
Length 1363 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh10a08    whvh13p09    rwhvh10a08    rwhvh13p09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0617800 [Oryza sativa (japonica cultivar-group)] >gi|108862969|gb|ABA99872.2| Potassium transporter, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649796|dbj|BAF30308.1| Os12g0617800 [Oryza sativa (japonica cultivar-group)] >gi|215697125|dbj|BAG91119.1| unnamed protein product [Oryza sativa Japonica Group]
Score 778
Evalue 1.33197e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1027
TTTTTTTTTTAGCAGGCAATGCTTCAGGTTCATTCAGAAAGTTCAACTTGTCGCGGCGAGGACAAACCGCTTTGGTCCAGTATTATTATACACTCACTAG
TTTCTGCATGTGCGCATGTACATGATTTTTTTTACAGGAATTATTTGGCCTACGGTCCTAGTTGTATACAACAGACACAAATCAGAGAAATGTGATACAA
ATAATTATCTAGCCATACAGGTTACTTCTGCTTGCACAAATCACCCTGCCAATAATGCTTTTCAGGGATTCTGAAATGTTGATGCTTCAATTTCTAAATG
CCCGCCGCAAATTCCAATCACGGCTGTAAATCTCAATATGCCCGAATTGACATTTCCGGTTTCAATTTGCGAGCTGCAAATCTCAGCTCGCACGACGCAG
TGCAAACGTCGTGTCCACAGATTGTGTGCCTCCAAGTTTCGGCGCTTCAGTCTCCAGATGTGCTGTACAATGAGAGCTATTACCTATGAGGAAACCACAA
GTTCAGTGCCTTCGCTTCAGACTGCGCCTTGGTTTTACAGAAACTGGTCTGGTCCGTCATCTCCTTGCTTCCGCTGGAGGCTCCACCGTTTCCTCGCCGT
CAGCGGTTTCCAGGAGACAATATTTCACACCGTCTTCAGATTCGTTTTTGTTGTTCAAATTAGGCATGGGATTATCCGGAGTCGTTTTCATCACCCGTAC
CTCCGGACGACTGCTTAGACCTAGCGATTGCTCCCGGGGAATCATTCCGGAACCGTTCCCATTGGACTCAACCAAGTCCGATACCCTAACCTGAAGTGAC
TCCATGGTAGTAGTTTCACGAGACTCGACGTTGTTGAGTGCCTCCTGAAGCTTGTAACTCCATCGAGTCCCTCACAAGCTTACTCAGGAAAGATACATCA
TCAGACATGACACCCAGCCCTTTCATAAGCATCGAGCCGAGTTGCAAGCTAGTCTCAGCATTTTCCAGAACAACATCTGTCGCACCTGCTTTCCTTAGAT
CCAACAAATGAGACATGTCTTGAGCCCTAACATACACGGGAACCGCAGGAAAAGCTTGTCGCAATCTGTCGACAGACTCGACTGTTTCTTCCTTCCCGGT
ATACATGATCATGACAGCTTTAGGAGAAGATATGCCAGCAGATTGCATAACGGCGGGGCGTGAACCATCTCCATATAACACTGGAAATCCTGATTTTCTG
GCTGACTTTACAACAGCAGGATTTAGATCAAACGCGACATACGGCCATCCTTCTGTATCTCGCTCGAGCCCGAAAGATAATGGTGCAGCCAAAAACTTTG
CAAGGACCTGTCCCATCTCTCCAAAGCCAAGAATGACAATAGGTTCAGTCGCACCATAATTGC
page-top