Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1016
Contig Information
Length 761 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh10c06    rwhvh10c06    rwhvh5h09    rwhvh5m09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase precursor [Triticum aestivum]
Score 1020
Evalue 4.77326e-109
Total Hit Count 328
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1016
CTCTGTCTTCTTCAAGACTCAAGCTGATGGCCACGTTTCCTGTGCCAAGGAGATGACCAAGCTCTCTGGAATCTCTGACATTATCCCTGAGATGGAGGTC
TGTGACTTCGACTTCGAGCCCTGCGGCTACTCCATGAACGCCATCAACGGATCTGCCGTCTCCACCATCCATGTGACCCCCGAGGACGGCTTCAGCTACG
CGAGCTACGAGGTCATGGGCATGGACGCCTCCGCCCTGGCCTACGGCGACATCGTCAAGAGGGTCCTCCGGTGCTTTGGCCCTTCAGAGTTCTCTGTGGC
GGTCACCATCTTCGGTGGCCGTGGCCACGCCGCCACCTGGGGCAAGAAGCTCCAAGCTGAGGCATACGACTGCAACAACGTTGTGGAGCAGGAGCTCCCC
TGCGGGGGCGTCCTCATCTACCAGAGCTTTGCCGCGAACGAAGAGGTTGCTGTCTCTGCCGGGTCGCCCAGGTCCGTCTTCCACTGCTTCGAGGCCGAGA
GTGTGCAGAGCCACCCTCTGGTCAAGGAAGGCAAGCTCGCCAACCTCCTCGCATGGCGGGCGGAGGAGGATTCCCTGGAGGAGGGCGCGGTGCTGTGCGA
GTGATTGGCTGTCGCTGTTCCGTCTGTGGACTTTGTTCTGACTAAGTTTGTCGTTTGGTTACTGTGAAGCAGCTGGCCAGGCTATTGCTACTCCGAATAA
ACTATTAGCTCTAGGTGGTTTGCTGCGTCTGCCACAATGAAGCGTACTTCTGGGGAGAAGT
page-top