Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1010
Contig Information
Length 556 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh10a03    whvh10a04    rwhvh10a03    rwhvh10a04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_29312 [Oryza sativa Indica Group]
Score 465
Evalue 5.31493e-45
Total Hit Count 246
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1010
GAATGATACTTCGTTTCTTGCGTCGGCGGATGTCATGGATTACTCGCTTCTTGTTGGAATCGACGAGGAGAAGAAAGAACTCGTCATTGGCATCATCGAT
TACTTGCGCCAATACACCTGGGACAAACAACTTGAGACTTGGGTGAAGGCCTCTGGCATCCTGGGAGGCCCCAAGAACGAAGCCCCCACCATTATATCCC
CGATGCAGTACAAGAAGAGGTTCAGGAAGGCCATGTCCAAGTACTTCCTCACCGTCCCTGATCAATGGACCTCTTAACAACTACTCGTAGCGATTAACTA
GACCGCCAGAAGCGTTCTGGCAACAGCGAATGTTGCGGTGAGGATCAGCTGATTCATTTTGTACACAGTTGTGGCAATTGGGCTGTAGGCATAGGTAGGA
TCACCCTCTCCCTGGATACCAAGCATGCTAATTGCAGTGTCCAGCCAAAGATAGGAGGTGTGATCGTTGTACATTGTGACCAACATAGTTACAAGACAAA
GTTATCATATAATGCAGAGGAAGGTACTTCTGCTACATTAGGTTGTAAAAAAAAAA
page-top