Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1001
Contig Information
Length 845 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh10d14    whvh13b23    rwhvh10d14    rwhvh13b23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative two component, sigma54 specific, transcriptional regulator, Fis family [Desulfovibrio vulgaris str. 'Miyazaki F'] >gi|218758684|gb|ACL09583.1| putative two component, sigma54 specific, transcriptional regulator, Fis family [Desulfovibrio vulgaris str. 'Miyazaki F']
Score 87
Evalue 0.894897
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1001
GAGCAAAAGTGGTGCCAGGGCCGTCATCGGGTATCTAAGGCGAAGGAGCAACAGGCACCACCACGGATGAGCCGGCTGCGCGGTTCTAGATGCTCCATCG
AGAAAAGTCGTCGAGCGGGGAGCTGCTTCGCCTGCCGTCTCATGCCCTGGCCCTGGCATCCTACACGACGGCGGGTCGACCACGACGCTATACAACATCG
CCTGCTGGGGCGTGCCACCGCCGCATGGGCCTCCGCGCGAGCCGCCCATACCCCACGCGCCCCCGCTCCTCCCACACCCGTGCGCTACCTACAGCCCGAG
GGAACAAGCGCCGCCCACGCGCCGGTGGCCATGCCAACGGGCTTCTAGCCTCGCACGCTGCCTGCCGATTCGAACTGCACTTTCCCCGTTTTTTCTTATT
CCCGGACAAGCAGCAGCACAAATGTAGGAGGTATTTGACAACAATGGCTGCGGTACCACTCCGTTCGACCCCGGTCTTCCTCTACCTCGGATAGCCGCTG
CTCTTCTCTCTCCTTGCTAAAGCTCTGAAAAGAAATGAGCATATCATTACTGATAAGTTAGTTGCAAGTTTGCAATCTTCTGTAAGAACCTGAAGTACTT
TATTTCATAGTTTGGATTGTGAAAGAATTTTGGAAGGATCACAAGGTAGTCTTCATTTCAATTTGTCCATTTATTGGGTCGATGCATCTAGCTACCTGTA
GCTGTTTTCTTCTATTGTAAAATGAAATATCATTCTTGCTGATGATTGAAACTAGAAAATCAGCAGACTACATTGTTCAAATTGCAAGATTCCTTCCATT
GTAATGAATACAAAGGAAAATCACAAGTTTTGTTCAAAAAAAAAA
page-top