Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig1000
Contig Information
Length 717 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh10b23    whvh1m18    rwhvh10b23    rwhvh1m18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0566600 [Oryza sativa (japonica cultivar-group)] >gi|42409090|dbj|BAD10341.1| unknown protein [Oryza sativa Japonica Group] >gi|113624511|dbj|BAF24456.1| Os08g0566600 [Oryza sativa (japonica cultivar-group)] >gi|125562613|gb|EAZ08061.1| hypothetical protein OsI_30326 [Oryza sativa Indica Group] >gi|125604372|gb|EAZ43697.1| hypothetical protein OsJ_027180 [Oryza sativa (japonica cultivar-group)] >gi|215694676|dbj|BAG89867.1| unnamed protein product [Oryza sativa Japonica Group]
Score 486
Evalue 3.56725e-47
Total Hit Count 48
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig1000
ATTCTGCACGGCACAGCACAGCACAGCACAGCGGAGAAGAGGAAGGAGAGAGAGATGACTGCGTCCGTCTCCTACGGGCTGCGAGCTCTTCCGACGTGGT
CCAGCTCTGTGTCCGGTGACGACCACTGCTCGGCGCTGGCCATGTCGGTGTCGGCGCGGGGGCCCCGGTCGACGCGGCCCCTTCGGACGCCGGCGAGGAT
GGGCAATGTAAACGAGGGCAAGGGCATCTTCGCGCCCCTGGTGGTGGTGGTGCGCAACATCGTCGGACGCAAGCGCTTCAACCAGCTCAGGGGCAAGGCC
ATCGCGCTGCACTCCCAGGTGATCACCGAGTTCTGTAAGACCATCGGCGCTGACCCCAAGCAGAGGCAGGGCTTGATCCGCCTCGCCAAGAAGAACGGAG
AGAAGCTCGGATTCCTTGCTTGACCCGCCTCACAATCCCCCCTTCCTTCTCCTACCTTTTCTACTAGCAAAAAGGAAATTCCTTGGAGTTGGAGATTGCA
TGCATGCATGTATGTATACTAGTCTTATATATTTTTTCTTCTCTTCTCTTCTCTTCTCTTGTGGAGACAGCACTGAGTTCAGTTAAACTTCAGTTCCATG
TGGATAGATGGATGGACAGATGATGTATCTATCCTCTACTGATGACCTCAGCGGTAGAGTATATATATGCGCAATGCTACTGGATAAATAATTCAAGTAT
TTGTCTCAAAAAAAAAA
page-top