Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VHS_all.Contig998
Contig Information
Length 626 bp
Tissue Shoot with heat shock treatment
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvh10b18    whvh5g23    rwhvh10b18    rwhvh5g23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195642428|gb|ACG40682.1| 50S ribosomal protein L17 [Zea mays]
Score 635
Evalue 1.39012e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VHS_all.Contig998
GTGGAATCGAGCTTTGCTCACCGACTGTTTGGCATTGATGTCCGTGGAAGGATATTGGCGATGAGGCACGGGAAGCGCATTCCTAGGCTCAACAGGCCCG
CAGATCAGCGGAAAGCACTCCTGCGTGGGCTGACCACACAGCTGCTGAAGCACGGGAGGATAAAGACTACCAAGCCAAGGGCAAAGGCGATGAGGAAGTG
GGTTGACAAGATGATCACGATGGCGAAGGATGGATCTCTTCACAAGAGGAGGCAGGCCCTGGGGTATATCTATGAGAAGCACATAGTCCATGCATTGTTT
GCTGAGGTTCCAGACAGGTATGGGGAAAGAGATGGGGGCTACACAAGGATCATCCCGACATTCCCAAGGCGGGGAGATAATGCACCTATGGCTTACATCG
AACTTGTCTAGAGAATCATCCATTGGTTGCAGTCCATCCATCGACGCTGCTCAAGCCGGGTGTCTGCGAATCGCCTTTTGAACTTGTGTTTTCATATGTT
ATTTTGTAACAACAAAGTGTAGATCATGTCGCGGAATTTTTGAACAAACGAATATCATCCTGTGACTGCAAGATCAGTGTGCTATACTAGTATATTTTGG
AATGGCTCCTTACTTCAAAAAAAAAA
page-top